ID: 1124497001

View in Genome Browser
Species Human (GRCh38)
Location 15:30192857-30192879
Sequence TCTGGGACAGACTGAGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497001_1124497011 -5 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497011 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
1124497001_1124497017 27 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497017 15:30192907-30192929 TCTTCACCGGCCACCTGGAGAGG No data
1124497001_1124497018 28 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497018 15:30192908-30192930 CTTCACCGGCCACCTGGAGAGGG No data
1124497001_1124497019 29 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497019 15:30192909-30192931 TTCACCGGCCACCTGGAGAGGGG No data
1124497001_1124497014 14 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497014 15:30192894-30192916 CTGGTGCCAGGGCTCTTCACCGG No data
1124497001_1124497013 3 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497013 15:30192883-30192905 TGAGGTCAAGGCTGGTGCCAGGG No data
1124497001_1124497012 2 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497001_1124497016 22 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497001_1124497008 -9 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497008 15:30192871-30192893 TGTCCCAGAGGGTGAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497001 Original CRISPR TCTGGGACAGACTGAGGCAG GGG (reversed) Intergenic
No off target data available for this crispr