ID: 1124497005

View in Genome Browser
Species Human (GRCh38)
Location 15:30192860-30192882
Sequence CTGCCTCAGTCTGTCCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124496998_1124497005 -5 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data
1124496996_1124497005 4 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data
1124496995_1124497005 5 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data
1124496994_1124497005 6 Left 1124496994 15:30192831-30192853 CCCCGAGGGCTCCGGCAGCCCGC No data
Right 1124497005 15:30192860-30192882 CTGCCTCAGTCTGTCCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497005 Original CRISPR CTGCCTCAGTCTGTCCCAGA GGG Intergenic
No off target data available for this crispr