ID: 1124497006

View in Genome Browser
Species Human (GRCh38)
Location 15:30192863-30192885
Sequence TCACCCTCTGGGACAGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497006_1124497014 8 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497014 15:30192894-30192916 CTGGTGCCAGGGCTCTTCACCGG No data
1124497006_1124497016 16 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497006_1124497013 -3 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497013 15:30192883-30192905 TGAGGTCAAGGCTGGTGCCAGGG No data
1124497006_1124497012 -4 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497006_1124497019 23 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497019 15:30192909-30192931 TTCACCGGCCACCTGGAGAGGGG No data
1124497006_1124497017 21 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497017 15:30192907-30192929 TCTTCACCGGCCACCTGGAGAGG No data
1124497006_1124497018 22 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497018 15:30192908-30192930 CTTCACCGGCCACCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497006 Original CRISPR TCACCCTCTGGGACAGACTG AGG (reversed) Intergenic