ID: 1124497010

View in Genome Browser
Species Human (GRCh38)
Location 15:30192875-30192897
Sequence CCAGCCTTGACCTCACCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497010_1124497027 30 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497027 15:30192928-30192950 GGGGAGAAAGAGGGATGCAGGGG No data
1124497010_1124497019 11 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497019 15:30192909-30192931 TTCACCGGCCACCTGGAGAGGGG No data
1124497010_1124497022 20 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497022 15:30192918-30192940 CACCTGGAGAGGGGAGAAAGAGG No data
1124497010_1124497017 9 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497017 15:30192907-30192929 TCTTCACCGGCCACCTGGAGAGG No data
1124497010_1124497023 21 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497023 15:30192919-30192941 ACCTGGAGAGGGGAGAAAGAGGG No data
1124497010_1124497016 4 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497010_1124497026 29 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497026 15:30192927-30192949 AGGGGAGAAAGAGGGATGCAGGG No data
1124497010_1124497025 28 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497025 15:30192926-30192948 GAGGGGAGAAAGAGGGATGCAGG No data
1124497010_1124497018 10 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497018 15:30192908-30192930 CTTCACCGGCCACCTGGAGAGGG No data
1124497010_1124497014 -4 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497014 15:30192894-30192916 CTGGTGCCAGGGCTCTTCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497010 Original CRISPR CCAGCCTTGACCTCACCCTC TGG (reversed) Intergenic