ID: 1124497012

View in Genome Browser
Species Human (GRCh38)
Location 15:30192882-30192904
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124496998_1124497012 17 Left 1124496998 15:30192842-30192864 CCGGCAGCCCGCGGTCCCCTGCC No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124496995_1124497012 27 Left 1124496995 15:30192832-30192854 CCCGAGGGCTCCGGCAGCCCGCG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497003_1124497012 0 Left 1124497003 15:30192859-30192881 CCTGCCTCAGTCTGTCCCAGAGG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497002_1124497012 1 Left 1124497002 15:30192858-30192880 CCCTGCCTCAGTCTGTCCCAGAG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124496994_1124497012 28 Left 1124496994 15:30192831-30192853 CCCCGAGGGCTCCGGCAGCCCGC No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124496996_1124497012 26 Left 1124496996 15:30192833-30192855 CCGAGGGCTCCGGCAGCCCGCGG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497000_1124497012 9 Left 1124497000 15:30192850-30192872 CCGCGGTCCCCTGCCTCAGTCTG No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497006_1124497012 -4 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124497001_1124497012 2 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data
1124496999_1124497012 10 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497012 15:30192882-30192904 GTGAGGTCAAGGCTGGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497012 Original CRISPR GTGAGGTCAAGGCTGGTGCC AGG Intergenic