ID: 1124497016

View in Genome Browser
Species Human (GRCh38)
Location 15:30192902-30192924
Sequence AGGGCTCTTCACCGGCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497006_1124497016 16 Left 1124497006 15:30192863-30192885 CCTCAGTCTGTCCCAGAGGGTGA No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497010_1124497016 4 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497002_1124497016 21 Left 1124497002 15:30192858-30192880 CCCTGCCTCAGTCTGTCCCAGAG No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497003_1124497016 20 Left 1124497003 15:30192859-30192881 CCTGCCTCAGTCTGTCCCAGAGG No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497009_1124497016 5 Left 1124497009 15:30192874-30192896 CCCAGAGGGTGAGGTCAAGGCTG No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124496999_1124497016 30 Left 1124496999 15:30192849-30192871 CCCGCGGTCCCCTGCCTCAGTCT No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497001_1124497016 22 Left 1124497001 15:30192857-30192879 CCCCTGCCTCAGTCTGTCCCAGA No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data
1124497000_1124497016 29 Left 1124497000 15:30192850-30192872 CCGCGGTCCCCTGCCTCAGTCTG No data
Right 1124497016 15:30192902-30192924 AGGGCTCTTCACCGGCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497016 Original CRISPR AGGGCTCTTCACCGGCCACC TGG Intergenic