ID: 1124497020

View in Genome Browser
Species Human (GRCh38)
Location 15:30192913-30192935
Sequence TTCTCCCCTCTCCAGGTGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497020_1124497029 -2 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497029 15:30192934-30192956 AAAGAGGGATGCAGGGGTACGGG No data
1124497020_1124497031 3 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497031 15:30192939-30192961 GGGATGCAGGGGTACGGGGTTGG No data
1124497020_1124497032 4 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497032 15:30192940-30192962 GGATGCAGGGGTACGGGGTTGGG No data
1124497020_1124497028 -3 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497028 15:30192933-30192955 GAAAGAGGGATGCAGGGGTACGG No data
1124497020_1124497036 29 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497036 15:30192965-30192987 AGAGGAGGAAGAGCGTCTGCTGG No data
1124497020_1124497034 11 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497034 15:30192947-30192969 GGGGTACGGGGTTGGGGCAGAGG No data
1124497020_1124497025 -10 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497025 15:30192926-30192948 GAGGGGAGAAAGAGGGATGCAGG No data
1124497020_1124497035 14 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497035 15:30192950-30192972 GTACGGGGTTGGGGCAGAGGAGG No data
1124497020_1124497030 -1 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497030 15:30192935-30192957 AAGAGGGATGCAGGGGTACGGGG No data
1124497020_1124497027 -8 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497027 15:30192928-30192950 GGGGAGAAAGAGGGATGCAGGGG No data
1124497020_1124497033 5 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497033 15:30192941-30192963 GATGCAGGGGTACGGGGTTGGGG No data
1124497020_1124497026 -9 Left 1124497020 15:30192913-30192935 CCGGCCACCTGGAGAGGGGAGAA No data
Right 1124497026 15:30192927-30192949 AGGGGAGAAAGAGGGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497020 Original CRISPR TTCTCCCCTCTCCAGGTGGC CGG (reversed) Intergenic