ID: 1124497022

View in Genome Browser
Species Human (GRCh38)
Location 15:30192918-30192940
Sequence CACCTGGAGAGGGGAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497010_1124497022 20 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497022 15:30192918-30192940 CACCTGGAGAGGGGAGAAAGAGG No data
1124497009_1124497022 21 Left 1124497009 15:30192874-30192896 CCCAGAGGGTGAGGTCAAGGCTG No data
Right 1124497022 15:30192918-30192940 CACCTGGAGAGGGGAGAAAGAGG No data
1124497015_1124497022 -5 Left 1124497015 15:30192900-30192922 CCAGGGCTCTTCACCGGCCACCT No data
Right 1124497022 15:30192918-30192940 CACCTGGAGAGGGGAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497022 Original CRISPR CACCTGGAGAGGGGAGAAAG AGG Intergenic