ID: 1124497023

View in Genome Browser
Species Human (GRCh38)
Location 15:30192919-30192941
Sequence ACCTGGAGAGGGGAGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124497010_1124497023 21 Left 1124497010 15:30192875-30192897 CCAGAGGGTGAGGTCAAGGCTGG No data
Right 1124497023 15:30192919-30192941 ACCTGGAGAGGGGAGAAAGAGGG No data
1124497015_1124497023 -4 Left 1124497015 15:30192900-30192922 CCAGGGCTCTTCACCGGCCACCT No data
Right 1124497023 15:30192919-30192941 ACCTGGAGAGGGGAGAAAGAGGG No data
1124497009_1124497023 22 Left 1124497009 15:30192874-30192896 CCCAGAGGGTGAGGTCAAGGCTG No data
Right 1124497023 15:30192919-30192941 ACCTGGAGAGGGGAGAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124497023 Original CRISPR ACCTGGAGAGGGGAGAAAGA GGG Intergenic