ID: 1124499965

View in Genome Browser
Species Human (GRCh38)
Location 15:30219275-30219297
Sequence GTCAATACTCATATTAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124499960_1124499965 7 Left 1124499960 15:30219245-30219267 CCAAGCCCATTCTTTGTTATCTA No data
Right 1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG No data
1124499959_1124499965 8 Left 1124499959 15:30219244-30219266 CCCAAGCCCATTCTTTGTTATCT No data
Right 1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG No data
1124499962_1124499965 1 Left 1124499962 15:30219251-30219273 CCATTCTTTGTTATCTATTGTAA No data
Right 1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG No data
1124499961_1124499965 2 Left 1124499961 15:30219250-30219272 CCCATTCTTTGTTATCTATTGTA No data
Right 1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG No data
1124499957_1124499965 23 Left 1124499957 15:30219229-30219251 CCATGTCTGATTCCTCCCAAGCC No data
Right 1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG No data
1124499958_1124499965 11 Left 1124499958 15:30219241-30219263 CCTCCCAAGCCCATTCTTTGTTA No data
Right 1124499965 15:30219275-30219297 GTCAATACTCATATTAGGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124499965 Original CRISPR GTCAATACTCATATTAGGTA GGG Intergenic
No off target data available for this crispr