ID: 1124500332

View in Genome Browser
Species Human (GRCh38)
Location 15:30222987-30223009
Sequence CCCCGCGCGCGTCCATGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124500332_1124500341 -6 Left 1124500332 15:30222987-30223009 CCTCGCCATGGACGCGCGCGGGG No data
Right 1124500341 15:30223004-30223026 GCGGGGGCGGCGGGCGGCCCGGG No data
1124500332_1124500340 -7 Left 1124500332 15:30222987-30223009 CCTCGCCATGGACGCGCGCGGGG No data
Right 1124500340 15:30223003-30223025 CGCGGGGGCGGCGGGCGGCCCGG No data
1124500332_1124500342 -5 Left 1124500332 15:30222987-30223009 CCTCGCCATGGACGCGCGCGGGG No data
Right 1124500342 15:30223005-30223027 CGGGGGCGGCGGGCGGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124500332 Original CRISPR CCCCGCGCGCGTCCATGGCG AGG (reversed) Intergenic
No off target data available for this crispr