ID: 1124509417

View in Genome Browser
Species Human (GRCh38)
Location 15:30310354-30310376
Sequence TAGGCCCACCTGGATTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124509417_1124509420 -10 Left 1124509417 15:30310354-30310376 CCACCAAAATCCAGGTGGGCCTA No data
Right 1124509420 15:30310367-30310389 GGTGGGCCTAGCTGACACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124509417 Original CRISPR TAGGCCCACCTGGATTTTGG TGG (reversed) Intergenic
No off target data available for this crispr