ID: 1124509546

View in Genome Browser
Species Human (GRCh38)
Location 15:30311660-30311682
Sequence GGCCCCTAGAAACTTCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124509546_1124509549 -10 Left 1124509546 15:30311660-30311682 CCTCAGTGAAGTTTCTAGGGGCC No data
Right 1124509549 15:30311673-30311695 TCTAGGGGCCTAGTGCTGTGGGG No data
1124509546_1124509551 14 Left 1124509546 15:30311660-30311682 CCTCAGTGAAGTTTCTAGGGGCC No data
Right 1124509551 15:30311697-30311719 GTGTCAAAATATCCCTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124509546 Original CRISPR GGCCCCTAGAAACTTCACTG AGG (reversed) Intergenic
No off target data available for this crispr