ID: 1124509549

View in Genome Browser
Species Human (GRCh38)
Location 15:30311673-30311695
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124509546_1124509549 -10 Left 1124509546 15:30311660-30311682 CCTCAGTGAAGTTTCTAGGGGCC No data
Right 1124509549 15:30311673-30311695 TCTAGGGGCCTAGTGCTGTGGGG No data
1124509542_1124509549 15 Left 1124509542 15:30311635-30311657 CCAACTAAAATGCAAGGGCATTC No data
Right 1124509549 15:30311673-30311695 TCTAGGGGCCTAGTGCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124509549 Original CRISPR TCTAGGGGCCTAGTGCTGTG GGG Intergenic