ID: 1124509551

View in Genome Browser
Species Human (GRCh38)
Location 15:30311697-30311719
Sequence GTGTCAAAATATCCCTTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124509546_1124509551 14 Left 1124509546 15:30311660-30311682 CCTCAGTGAAGTTTCTAGGGGCC No data
Right 1124509551 15:30311697-30311719 GTGTCAAAATATCCCTTGTAAGG No data
1124509550_1124509551 -7 Left 1124509550 15:30311681-30311703 CCTAGTGCTGTGGGGTGTGTCAA No data
Right 1124509551 15:30311697-30311719 GTGTCAAAATATCCCTTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124509551 Original CRISPR GTGTCAAAATATCCCTTGTA AGG Intergenic
No off target data available for this crispr