ID: 1124510697

View in Genome Browser
Species Human (GRCh38)
Location 15:30322005-30322027
Sequence GCATAATTGAAGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124510697_1124510700 -3 Left 1124510697 15:30322005-30322027 CCACACCTGGCCTTCAATTATGC No data
Right 1124510700 15:30322025-30322047 TGCTTTTATGTGTGTCCATATGG No data
1124510697_1124510706 27 Left 1124510697 15:30322005-30322027 CCACACCTGGCCTTCAATTATGC No data
Right 1124510706 15:30322055-30322077 CACTTACCTTGGAGCTTTGTTGG No data
1124510697_1124510702 16 Left 1124510697 15:30322005-30322027 CCACACCTGGCCTTCAATTATGC No data
Right 1124510702 15:30322044-30322066 ATGGCCCCAGTCACTTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124510697 Original CRISPR GCATAATTGAAGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr