ID: 1124513611

View in Genome Browser
Species Human (GRCh38)
Location 15:30348085-30348107
Sequence GTGGTGGGATGGCCTGCGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124513611_1124513620 23 Left 1124513611 15:30348085-30348107 CCTCTCGCAGGCCATCCCACCAC No data
Right 1124513620 15:30348131-30348153 AATGTTCCATTACTGTTCACCGG No data
1124513611_1124513614 -8 Left 1124513611 15:30348085-30348107 CCTCTCGCAGGCCATCCCACCAC No data
Right 1124513614 15:30348100-30348122 CCCACCACACTCGTCCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124513611 Original CRISPR GTGGTGGGATGGCCTGCGAG AGG (reversed) Intergenic
No off target data available for this crispr