ID: 1124516478

View in Genome Browser
Species Human (GRCh38)
Location 15:30370929-30370951
Sequence AGTCACCCGGGCCCAAGTAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 46}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124516478_1124516483 19 Left 1124516478 15:30370929-30370951 CCCTTACTTGGGCCCGGGTGACT 0: 1
1: 1
2: 0
3: 2
4: 46
Right 1124516483 15:30370971-30370993 CATCACCTTCCAGAGAAAATGGG 0: 2
1: 0
2: 1
3: 18
4: 310
1124516478_1124516482 18 Left 1124516478 15:30370929-30370951 CCCTTACTTGGGCCCGGGTGACT 0: 1
1: 1
2: 0
3: 2
4: 46
Right 1124516482 15:30370970-30370992 TCATCACCTTCCAGAGAAAATGG 0: 2
1: 0
2: 2
3: 24
4: 317
1124516478_1124516484 20 Left 1124516478 15:30370929-30370951 CCCTTACTTGGGCCCGGGTGACT 0: 1
1: 1
2: 0
3: 2
4: 46
Right 1124516484 15:30370972-30370994 ATCACCTTCCAGAGAAAATGGGG 0: 2
1: 0
2: 1
3: 26
4: 252
1124516478_1124516485 21 Left 1124516478 15:30370929-30370951 CCCTTACTTGGGCCCGGGTGACT 0: 1
1: 1
2: 0
3: 2
4: 46
Right 1124516485 15:30370973-30370995 TCACCTTCCAGAGAAAATGGGGG 0: 2
1: 0
2: 0
3: 25
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124516478 Original CRISPR AGTCACCCGGGCCCAAGTAA GGG (reversed) Intronic
901505080 1:9679668-9679690 AGTCACTGGTGCCCAAGGAATGG - Intronic
906325203 1:44841315-44841337 AGGCACCCAGGCCCATTTAATGG - Intronic
912539944 1:110407343-110407365 AGTCTCCCGGGCCCAGGCCACGG - Intronic
921947170 1:220894240-220894262 AGTTACCCGGACGCAAGTTAAGG + Intergenic
922498933 1:226083080-226083102 AGTCGCCCGGGCCGCAGGAAGGG - Intergenic
923400963 1:233614823-233614845 AGCCACCCAGGCCGAAGTTAGGG - Intronic
924194258 1:241588411-241588433 AGTCACGCGAGCACAAGGAAAGG - Intronic
1064031832 10:11887591-11887613 AGGCATCAGGGCCCAAGTGAGGG + Intergenic
1065723971 10:28652635-28652657 AGTAACGCAGCCCCAAGTAAAGG - Intergenic
1069376977 10:67802953-67802975 ACACACCCGGGCTCAAGTAACGG + Intronic
1069829847 10:71276398-71276420 AGTCACTGGGGCCCAAGCCAGGG + Intronic
1074781047 10:116802666-116802688 AGTCACCGGGGCCACAGGAAGGG + Intergenic
1084457841 11:69278610-69278632 AGCCACCAGAGCCCAAGTGAGGG + Intergenic
1084981369 11:72830462-72830484 AGTCACTCTGGCCATAGTAAGGG - Intronic
1101848943 12:108387106-108387128 ACTCACTGGGGCCCAAGCAAGGG + Intergenic
1102618641 12:114176201-114176223 AGTCACCCGGGGCCCAGACATGG + Intergenic
1107708555 13:43130947-43130969 TGCCACCTGGGCCCAAGCAAGGG + Intergenic
1113281571 13:108794156-108794178 AGACACCAGGGCCCACTTAAGGG + Intronic
1113710627 13:112462001-112462023 AGGCACCTGAGCCCAAGAAAAGG + Intergenic
1124516478 15:30370929-30370951 AGTCACCCGGGCCCAAGTAAGGG - Intronic
1124726440 15:32159802-32159824 AGTCACCCAGGCCCAAGTAAGGG + Intronic
1134456900 16:14401625-14401647 AGTCTCCCAGGCCCCAGTAAAGG - Intergenic
1136765676 16:32774715-32774737 ATTCACCAGGGCACAAGGAAGGG - Intergenic
1137447455 16:48540391-48540413 AGCCACCCAGGCCCAAGTCCCGG + Exonic
1141152743 16:81575491-81575513 AGTGATCCAGGCCCCAGTAAGGG + Intronic
1141235383 16:82211189-82211211 AGTCACCCTGGCCAGAGTAGTGG + Intergenic
1143135586 17:4710729-4710751 AGAAACCCGGGACCAGGTAAGGG + Exonic
1148195380 17:45709282-45709304 AGTGGCCCGGGCCCATGGAAAGG - Intergenic
1152313105 17:79562832-79562854 AGTCCACGGGGCCCAGGTAAGGG + Intergenic
1161281595 19:3448671-3448693 AGTCACCCGAGCCCTAGAGAAGG - Intronic
1161726261 19:5931017-5931039 AGTCACTAGGGCCCGAGGAACGG - Intronic
1162968092 19:14165246-14165268 AGTCCCCAGGGCCCAAGCCAGGG - Intronic
1163863185 19:19753098-19753120 AGTCAGCCGGGGCCTAGTCACGG - Intergenic
928171360 2:29006578-29006600 AGTCATCAGGCCCCAAGAAACGG - Intronic
941588488 2:167389356-167389378 AATCACCTGGGCCCAATTAGTGG - Intergenic
944523809 2:200598067-200598089 AGTCACCCAGGCTGAAGTACAGG - Intronic
1177558404 21:22719584-22719606 GGTCACCTGGGTCCAAGGAATGG + Intergenic
1183350023 22:37329857-37329879 ACTCACCCAGGCCCCAGTGAGGG + Intergenic
950843849 3:15995698-15995720 AGCCATCCTGTCCCAAGTAAGGG - Intergenic
955111274 3:55952701-55952723 AGTCCCCCTGCCCCAAGTATGGG + Intronic
958899656 3:99870959-99870981 AGTCACCCGGGGGCATGGAATGG - Intronic
962605659 3:137030928-137030950 AGTCAGCAGGGCCCCAGTCATGG - Intergenic
964412210 3:156409430-156409452 ATTCACCCTGGCCCAAGGAGGGG + Intronic
971308499 4:25504552-25504574 AGTCACGCAGGCCCACGTGAGGG + Intergenic
990244005 5:53844480-53844502 AGTCACCCTGTCACAACTAAGGG - Intergenic
996760322 5:126980271-126980293 AGTCACCCTGGGCCAAGGAGTGG - Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
1009788121 6:68364502-68364524 AGTCATGCGGGCACAAGAAAGGG - Intergenic
1032782845 7:135177981-135178003 TGTCACCCGGCGACAAGTAAGGG + Intergenic
1034025360 7:147697662-147697684 AGTCACCCTGTGCCACGTAAAGG - Intronic