ID: 1124521827

View in Genome Browser
Species Human (GRCh38)
Location 15:30411404-30411426
Sequence ATGATGTAGGGCCTTCCCTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 8, 1: 0, 2: 4, 3: 14, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124521819_1124521827 14 Left 1124521819 15:30411367-30411389 CCAGAGCCTCTTACCTCCAGATC 0: 18
1: 20
2: 6
3: 24
4: 207
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124521820_1124521827 8 Left 1124521820 15:30411373-30411395 CCTCTTACCTCCAGATCTTTCAG 0: 10
1: 12
2: 24
3: 28
4: 252
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124521816_1124521827 21 Left 1124521816 15:30411360-30411382 CCTCCACCCAGAGCCTCTTACCT 0: 2
1: 7
2: 15
3: 47
4: 389
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124521823_1124521827 1 Left 1124521823 15:30411380-30411402 CCTCCAGATCTTTCAGGGTAGCA 0: 10
1: 12
2: 12
3: 20
4: 126
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124521818_1124521827 15 Left 1124521818 15:30411366-30411388 CCCAGAGCCTCTTACCTCCAGAT 0: 18
1: 21
2: 6
3: 21
4: 174
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124521817_1124521827 18 Left 1124521817 15:30411363-30411385 CCACCCAGAGCCTCTTACCTCCA 0: 8
1: 3
2: 0
3: 34
4: 345
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122
1124521824_1124521827 -2 Left 1124521824 15:30411383-30411405 CCAGATCTTTCAGGGTAGCAGAT 0: 10
1: 13
2: 17
3: 12
4: 129
Right 1124521827 15:30411404-30411426 ATGATGTAGGGCCTTCCCTGTGG 0: 8
1: 0
2: 4
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124521827 Original CRISPR ATGATGTAGGGCCTTCCCTG TGG Exonic