ID: 1124522203

View in Genome Browser
Species Human (GRCh38)
Location 15:30413908-30413930
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 10, 1: 0, 2: 20, 3: 21, 4: 104}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124522203_1124522216 30 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522216 15:30413961-30413983 TGACTGACAAAACTTTGGTGGGG 0: 9
1: 11
2: 12
3: 20
4: 159
1124522203_1124522208 0 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522208 15:30413931-30413953 GGACTGGGCTGCTTGCTGAAGGG 0: 16
1: 10
2: 12
3: 24
4: 182
1124522203_1124522215 29 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522215 15:30413960-30413982 CTGACTGACAAAACTTTGGTGGG 0: 9
1: 14
2: 11
3: 21
4: 98
1124522203_1124522214 28 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522214 15:30413959-30413981 GCTGACTGACAAAACTTTGGTGG 0: 9
1: 11
2: 10
3: 9
4: 116
1124522203_1124522209 1 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522209 15:30413932-30413954 GACTGGGCTGCTTGCTGAAGGGG 0: 22
1: 8
2: 6
3: 20
4: 185
1124522203_1124522213 25 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522213 15:30413956-30413978 GGGGCTGACTGACAAAACTTTGG 0: 9
1: 8
2: 14
3: 22
4: 101
1124522203_1124522211 5 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522211 15:30413936-30413958 GGGCTGCTTGCTGAAGGGGTGGG 0: 21
1: 10
2: 6
3: 38
4: 321
1124522203_1124522212 6 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522212 15:30413937-30413959 GGCTGCTTGCTGAAGGGGTGGGG 0: 21
1: 10
2: 5
3: 31
4: 333
1124522203_1124522207 -1 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522207 15:30413930-30413952 AGGACTGGGCTGCTTGCTGAAGG 0: 6
1: 15
2: 9
3: 41
4: 240
1124522203_1124522210 4 Left 1124522203 15:30413908-30413930 CCTGGGGTGATTGGCGAGGGCAA 0: 10
1: 0
2: 20
3: 21
4: 104
Right 1124522210 15:30413935-30413957 TGGGCTGCTTGCTGAAGGGGTGG 0: 25
1: 7
2: 4
3: 36
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124522203 Original CRISPR TTGCCCTCGCCAATCACCCC AGG (reversed) Intronic
902542125 1:17163001-17163023 TTGCCCTCCCCCATCTGCCCGGG + Intergenic
902714456 1:18262877-18262899 TTGCAGTTGCCAACCACCCCTGG - Intronic
915510848 1:156386231-156386253 TTGGCCTCTCCAACCAGCCCAGG - Intergenic
1065219314 10:23480070-23480092 CTGCCCTCTACTATCACCCCTGG + Intergenic
1065918904 10:30374096-30374118 CTGCCCTCAGCAGTCACCCCTGG - Intronic
1068849728 10:61723511-61723533 TTGCCATAGCCAAGCACCACAGG + Intronic
1069981350 10:72255089-72255111 ATGCCCTGGCCTCTCACCCCAGG + Intergenic
1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG + Intronic
1073526208 10:104184649-104184671 TTCCCCACCCTAATCACCCCAGG + Intronic
1075016310 10:118912326-118912348 TCTCCCTCCCCACTCACCCCTGG + Intergenic
1083275446 11:61594564-61594586 CTGCCCTCACCCACCACCCCAGG - Intergenic
1083793629 11:65001941-65001963 CTGCCCTTGCCAATCTCACCTGG - Intergenic
1090752957 11:129763550-129763572 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1091214789 11:133894067-133894089 TTGCCTTCGCCCCCCACCCCTGG - Intergenic
1092171170 12:6374905-6374927 GTGCCCTCTCCCATCACCCCTGG + Exonic
1103248981 12:119483565-119483587 TTGCCCTTGGCAATCAGCACGGG + Intronic
1114069310 14:19095289-19095311 TTGCCCCAGCCCATCAACCCTGG - Intergenic
1114092951 14:19304713-19304735 TTGCCCCAGCCCATCAACCCTGG + Intergenic
1121135881 14:91498560-91498582 TGGCACGCGCCAATGACCCCAGG + Intronic
1121937098 14:98029907-98029929 TTGCCCTCGGCAGGCACCCAGGG - Intergenic
1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123573809 15:21644486-21644508 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1123610427 15:22087071-22087093 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1123645957 15:22437648-22437670 CTGCCCTCACCAATCACCCCAGG - Intergenic
1123667226 15:22617361-22617383 CCACCCTCGCCAATCATCCCTGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1123682924 15:22775624-22775646 CTGCCCTCACCAGTCACCCCAGG - Intronic
1123682961 15:22775773-22775795 CTGCCCTCACCGGTCACCCCAGG - Intronic
1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG + Intronic
1123762946 15:23446746-23446768 CTGCCCTCACCAGTCGCCCCAGG - Intronic
1124282854 15:28378994-28379016 CTGCCCTCACCAATCACCCCAGG + Intronic
1124299845 15:28532619-28532641 CTGCCCTCACCAATCACCCCAGG - Intronic
1124321067 15:28711928-28711950 CCACCCTCGCCAATCATCCCTGG - Intronic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124334670 15:28848147-28848169 CTGCCCTCACCAGTCACCCCAGG - Intergenic
1124334708 15:28848296-28848318 CTGCCCTCACCGGTCACCCCAGG - Intergenic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124562936 15:30791943-30791965 CCGCCCTCGCCAGTCATCCCTGG + Intergenic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124960419 15:34389436-34389458 CTGCCCTCGCCGATCACCCCGGG - Intronic
1124977048 15:34535657-34535679 CTGCCCTCGCCGATCACCCCGGG - Intronic
1129029062 15:72605441-72605463 CTGCCCTCAACAGTCACCCCAGG + Intergenic
1129474505 15:75775862-75775884 CTGCCCTCACCAACCACCCCAGG + Intergenic
1129838269 15:78727447-78727469 CTGCCCTCACCAATCACCCCAGG + Intronic
1130260263 15:82348931-82348953 CTGCCCTCACCAGTCATCCCTGG - Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130268467 15:82430502-82430524 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130280970 15:82520076-82520098 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130394973 15:83493877-83493899 TGGCCTTGGCCAAACACCCCAGG + Intronic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130472340 15:84236257-84236279 CTGCCCTCACCAGTCATCCCTGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130479831 15:84350828-84350850 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491939 15:84437301-84437323 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503553 15:84516341-84516363 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130594638 15:85240893-85240915 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1131895646 15:97026619-97026641 TTGCCCTCAGCAATCACCTCTGG + Intergenic
1132019236 15:98346160-98346182 TTGCCCACCCCAATCTACCCTGG + Intergenic
1132433958 15:101781734-101781756 CTGCCCTCACCAATTGCCCCAGG - Intergenic
1202982674 15_KI270727v1_random:378825-378847 TTGCCTTCCCTAATCACCCCAGG - Intergenic
1135199179 16:20421862-20421884 TTACCCTCTCCCCTCACCCCTGG + Intronic
1135219518 16:20601782-20601804 TTACCCTCTCCCCTCACCCCTGG - Intergenic
1135550894 16:23397481-23397503 CTGCCCTCCCCATTCACCCCTGG - Intronic
1138882755 16:61035273-61035295 TTGTTCTCCCCACTCACCCCAGG - Intergenic
1142129509 16:88426280-88426302 TTGTCCTTGCCACTGACCCCTGG - Intergenic
1142186178 16:88695715-88695737 TTGCCCTCGCCAAGGGCCACTGG - Intergenic
1143495824 17:7312177-7312199 GTGCCCTCCCCACTCATCCCTGG + Exonic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1151541715 17:74768013-74768035 ATGCCCTGGCCACCCACCCCTGG - Intronic
1152075779 17:78158865-78158887 GTGCCCTCCCCACTCATCCCTGG + Intronic
1157293004 18:46423282-46423304 TTGCCTTGGCCAATAGCCCCAGG - Intronic
1159297309 18:66510756-66510778 TTGCCCTCGTCAAATTCCCCCGG - Intronic
1159938341 18:74386397-74386419 CTGCCCTCTGCAATCACCCAGGG - Intergenic
1162940547 19:14006361-14006383 CGGCCGCCGCCAATCACCCCGGG - Intronic
1166743641 19:45129659-45129681 GTGCCCTCCCCACTCACCCCTGG + Intronic
924960030 2:26430-26452 CTGCCTTCCCTAATCACCCCAGG - Intergenic
935025090 2:99269200-99269222 TTGACCTCCTCAGTCACCCCTGG + Intronic
936906120 2:117537130-117537152 GTGCCCTGGCTACTCACCCCTGG + Intergenic
937927696 2:127179875-127179897 TTGCTCTTGCCAGACACCCCAGG - Intergenic
938114665 2:128595016-128595038 TGGCCTTCCCCACTCACCCCTGG + Intergenic
940329661 2:152460799-152460821 TTACCGTCTCCCATCACCCCTGG + Intronic
940359351 2:152781061-152781083 TTGCCCTCAGCAAACACCTCAGG + Intergenic
945783290 2:214203710-214203732 TAGCCCTCCCCAAGGACCCCTGG - Intronic
1169311575 20:4546461-4546483 TTCCCTGCTCCAATCACCCCAGG - Intergenic
1171088485 20:22261911-22261933 TTGCTCTTCCCACTCACCCCAGG + Intergenic
1171173936 20:23037175-23037197 CTTCCCTCCCCACTCACCCCCGG + Intergenic
1173979515 20:47212344-47212366 CTGCCATAGCCAATCACCACAGG + Intronic
1175993646 20:62802409-62802431 TTGCCTTTCCCAGTCACCCCTGG - Intergenic
1178707320 21:34886772-34886794 CTGCCCTCGCGGATCTCCCCCGG + Intronic
1179196565 21:39169621-39169643 TGCCCCTCCCCAATTACCCCAGG + Intergenic
1180152762 21:45960173-45960195 CTGCCCTTGCCAAGCATCCCAGG + Intergenic
1180487781 22:15817852-15817874 TTGCCCCAGCCCATCAACCCTGG - Intergenic
1182835034 22:33334935-33334957 TTCACCTCGCCGATCCCCCCAGG + Intronic
1183521665 22:38299227-38299249 CTGCCCTCGCCAAGCACCCTGGG + Intronic
1184438778 22:44496445-44496467 CTGCCCTCTCCAAGCTCCCCTGG - Exonic
1184690017 22:46113299-46113321 TTGGCGTTGCCCATCACCCCAGG + Intronic
950225393 3:11229314-11229336 TTGCTGTCCCCAAACACCCCAGG - Intronic
950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG + Intergenic
954622773 3:52005358-52005380 CTGCCCTCCCCAATCTCCCCTGG + Intergenic
956912046 3:73828172-73828194 TTTCCCTCTCCCCTCACCCCTGG - Intergenic
967055521 3:185825696-185825718 CTGCCCTCGCCTCTCACCTCCGG - Intergenic
976037055 4:80836549-80836571 TTGCCCTCTCTAATCACAACTGG + Intronic
986393524 5:7306158-7306180 CTGCCCTCACCAGTCACCCCAGG - Intergenic
986393561 5:7306307-7306329 CTGCCCTCACCGGTCACCCCAGG - Intergenic
988648399 5:33122112-33122134 TTGCCCTTGCCTATCACTCTTGG + Intergenic
991330511 5:65488018-65488040 TAGTCCAAGCCAATCACCCCAGG + Intergenic
999324925 5:150637990-150638012 TAGCCCTCCCCATTCACCCCTGG + Intronic
1003108184 6:3231327-3231349 TTGCCCTCCCCCTTCCCCCCAGG + Intronic
1006316972 6:33297164-33297186 TTGCCCTCAGCCTTCACCCCAGG + Intronic
1006593308 6:35173923-35173945 TGGCCCCCAGCAATCACCCCTGG - Intergenic
1013419017 6:109949470-109949492 TGGCCCTTGCCACCCACCCCAGG + Intergenic
1018595217 6:165471816-165471838 TTCTACTTGCCAATCACCCCTGG + Intronic
1019433980 7:1012363-1012385 TTCCCCTCGCCATCCACCCCAGG - Intronic
1022291600 7:29009785-29009807 TTGCCCTTCCTAATTACCCCTGG - Intronic
1022452262 7:30525955-30525977 CTGCCCTTGCCAATCTCCCCAGG - Intronic
1023860816 7:44216811-44216833 CTGACCTCTCCATTCACCCCCGG - Intergenic
1024142178 7:46472795-46472817 TTGCTCTCGCCATTGGCCCCTGG + Intergenic
1026107565 7:67433202-67433224 TCTCCCTCGCTAATCAACCCTGG + Intergenic
1026610735 7:71857662-71857684 TGGCACTGGCCAATCACCCCAGG + Intronic
1031923771 7:127619803-127619825 TTTCCCTCCCCCATCACCTCTGG - Intergenic
1033672584 7:143507150-143507172 TTCCCCACCCTAATCACCCCAGG + Intergenic
1041314188 8:56544561-56544583 TTCCCTTCCCTAATCACCCCAGG + Intergenic
1042252992 8:66775141-66775163 CCGCCCTCACCAATCACCACCGG - Intronic
1047504275 8:125466529-125466551 CTGCTCTGGCAAATCACCCCTGG - Intergenic
1047728117 8:127702280-127702302 TTTCCCTCCCCCATCTCCCCAGG - Intergenic
1048943382 8:139422523-139422545 TTGCCCTCAGCAAGCACCTCAGG - Intergenic
1049699739 8:144004855-144004877 GTGCCCACTCCATTCACCCCAGG - Intronic
1050202168 9:3157108-3157130 TTGCCCTGGCCAAACTCCACCGG + Intergenic
1050267413 9:3905649-3905671 TTTCCCTTGACGATCACCCCTGG + Intronic
1052894514 9:33734803-33734825 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1057168626 9:92947526-92947548 CTTCCCGCGCCAATCAGCCCAGG - Exonic
1057315554 9:93966304-93966326 TCGCCCTCTCCCATCACCCAGGG + Intergenic
1061065560 9:128275694-128275716 CCGCCCTCGCCAGTCGCCCCCGG - Intronic
1061627151 9:131847511-131847533 TAGCCCTCCCCACCCACCCCCGG - Intergenic
1196405416 X:115357139-115357161 TTGACCCAGGCAATCACCCCTGG + Intergenic
1199880958 X:151974199-151974221 CTGCCCTGGCCGGTCACCCCGGG + Intronic
1202366340 Y:24168454-24168476 TTGCCCTTGCCAGTCACCACAGG + Intergenic
1202374116 Y:24218035-24218057 CTGCCCTCACCAGTCATCCCTGG - Intergenic
1202374163 Y:24218190-24218212 TTGCCCTTGCCAATCACCACAGG - Intergenic
1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG + Intergenic
1202496665 Y:25452085-25452107 CTGCCCTCACCAGTCATCCCTGG + Intergenic
1202504441 Y:25501669-25501691 TTGCCCTTGCCAGTCACCACAGG - Intergenic