ID: 1124526100

View in Genome Browser
Species Human (GRCh38)
Location 15:30454485-30454507
Sequence ACAACACTCTGTTTTAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124526100_1124526102 10 Left 1124526100 15:30454485-30454507 CCTTTTTTAAAACAGAGTGTTGT No data
Right 1124526102 15:30454518-30454540 CATGTGGATCCCATCATTATAGG No data
1124526100_1124526101 -6 Left 1124526100 15:30454485-30454507 CCTTTTTTAAAACAGAGTGTTGT No data
Right 1124526101 15:30454502-30454524 TGTTGTCATGCTATATCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124526100 Original CRISPR ACAACACTCTGTTTTAAAAA AGG (reversed) Intergenic
No off target data available for this crispr