ID: 1124526102

View in Genome Browser
Species Human (GRCh38)
Location 15:30454518-30454540
Sequence CATGTGGATCCCATCATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124526100_1124526102 10 Left 1124526100 15:30454485-30454507 CCTTTTTTAAAACAGAGTGTTGT No data
Right 1124526102 15:30454518-30454540 CATGTGGATCCCATCATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124526102 Original CRISPR CATGTGGATCCCATCATTAT AGG Intergenic
No off target data available for this crispr