ID: 1124530285

View in Genome Browser
Species Human (GRCh38)
Location 15:30499730-30499752
Sequence CCATTTCCTCAGGCAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124530285_1124530291 -5 Left 1124530285 15:30499730-30499752 CCCTGCACTGCCTGAGGAAATGG No data
Right 1124530291 15:30499748-30499770 AATGGGAATGGCCTCCCGTAAGG No data
1124530285_1124530292 4 Left 1124530285 15:30499730-30499752 CCCTGCACTGCCTGAGGAAATGG No data
Right 1124530292 15:30499757-30499779 GGCCTCCCGTAAGGCAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124530285 Original CRISPR CCATTTCCTCAGGCAGTGCA GGG (reversed) Intergenic
No off target data available for this crispr