ID: 1124534071

View in Genome Browser
Species Human (GRCh38)
Location 15:30529389-30529411
Sequence AAGGCTAAAAAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124534071_1124534077 -3 Left 1124534071 15:30529389-30529411 CCCTCTTCCTTCTTTTTAGCCTT No data
Right 1124534077 15:30529409-30529431 CTTTTCAACAGTGGGAAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124534071 Original CRISPR AAGGCTAAAAAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr