ID: 1124536340

View in Genome Browser
Species Human (GRCh38)
Location 15:30551752-30551774
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124536340_1124536348 6 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data
1124536340_1124536355 24 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536340_1124536344 1 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536344 15:30551776-30551798 GCCTCTCCCCTCTCTTAGAGTGG No data
1124536340_1124536346 2 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536346 15:30551777-30551799 CCTCTCCCCTCTCTTAGAGTGGG No data
1124536340_1124536347 5 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536347 15:30551780-30551802 CTCCCCTCTCTTAGAGTGGGTGG No data
1124536340_1124536354 23 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536354 15:30551798-30551820 GGTGGGGAGAGCGGTTGCCACGG No data
1124536340_1124536353 14 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536353 15:30551789-30551811 CTTAGAGTGGGTGGGGAGAGCGG No data
1124536340_1124536350 7 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536350 15:30551782-30551804 CCCCTCTCTTAGAGTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124536340 Original CRISPR TCCCACTCTGGAAGAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr