ID: 1124536343

View in Genome Browser
Species Human (GRCh38)
Location 15:30551764-30551786
Sequence AGGGGAGAGGCCTCCCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124536343_1124536355 12 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536343_1124536346 -10 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536346 15:30551777-30551799 CCTCTCCCCTCTCTTAGAGTGGG No data
1124536343_1124536347 -7 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536347 15:30551780-30551802 CTCCCCTCTCTTAGAGTGGGTGG No data
1124536343_1124536354 11 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536354 15:30551798-30551820 GGTGGGGAGAGCGGTTGCCACGG No data
1124536343_1124536350 -5 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536350 15:30551782-30551804 CCCCTCTCTTAGAGTGGGTGGGG No data
1124536343_1124536348 -6 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data
1124536343_1124536353 2 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536353 15:30551789-30551811 CTTAGAGTGGGTGGGGAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124536343 Original CRISPR AGGGGAGAGGCCTCCCACTC TGG (reversed) Intergenic
No off target data available for this crispr