ID: 1124536348

View in Genome Browser
Species Human (GRCh38)
Location 15:30551781-30551803
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124536336_1124536348 11 Left 1124536336 15:30551747-30551769 CCAGCCCCTCTTCTCTTCCAGAG No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data
1124536340_1124536348 6 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data
1124536341_1124536348 5 Left 1124536341 15:30551753-30551775 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data
1124536343_1124536348 -6 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data
1124536338_1124536348 7 Left 1124536338 15:30551751-30551773 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124536348 15:30551781-30551803 TCCCCTCTCTTAGAGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124536348 Original CRISPR TCCCCTCTCTTAGAGTGGGT GGG Intergenic
No off target data available for this crispr