ID: 1124536355

View in Genome Browser
Species Human (GRCh38)
Location 15:30551799-30551821
Sequence GTGGGGAGAGCGGTTGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124536343_1124536355 12 Left 1124536343 15:30551764-30551786 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536338_1124536355 25 Left 1124536338 15:30551751-30551773 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536345_1124536355 -1 Left 1124536345 15:30551777-30551799 CCTCTCCCCTCTCTTAGAGTGGG No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536352_1124536355 -8 Left 1124536352 15:30551784-30551806 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536340_1124536355 24 Left 1124536340 15:30551752-30551774 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536349_1124536355 -6 Left 1124536349 15:30551782-30551804 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536341_1124536355 23 Left 1124536341 15:30551753-30551775 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536351_1124536355 -7 Left 1124536351 15:30551783-30551805 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data
1124536336_1124536355 29 Left 1124536336 15:30551747-30551769 CCAGCCCCTCTTCTCTTCCAGAG No data
Right 1124536355 15:30551799-30551821 GTGGGGAGAGCGGTTGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124536355 Original CRISPR GTGGGGAGAGCGGTTGCCAC GGG Intergenic
No off target data available for this crispr