ID: 1124542146

View in Genome Browser
Species Human (GRCh38)
Location 15:30596610-30596632
Sequence AAGAGAAGAGTCAGGGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542146_1124542150 8 Left 1124542146 15:30596610-30596632 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124542150 15:30596641-30596663 GTTTTCTCTCCGTTTACAGATGG No data
1124542146_1124542151 9 Left 1124542146 15:30596610-30596632 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124542151 15:30596642-30596664 TTTTCTCTCCGTTTACAGATGGG No data
1124542146_1124542152 15 Left 1124542146 15:30596610-30596632 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG No data
1124542146_1124542154 23 Left 1124542146 15:30596610-30596632 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124542154 15:30596656-30596678 ACAGATGGGCCAAGGTTGCTCGG No data
1124542146_1124542155 24 Left 1124542146 15:30596610-30596632 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542146 Original CRISPR AAGAGAAGAGTCAGGGACTG AGG (reversed) Intergenic