ID: 1124542147

View in Genome Browser
Species Human (GRCh38)
Location 15:30596617-30596639
Sequence GGCTCTGAAGAGAAGAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542147_1124542150 1 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542150 15:30596641-30596663 GTTTTCTCTCCGTTTACAGATGG No data
1124542147_1124542156 24 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data
1124542147_1124542154 16 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542154 15:30596656-30596678 ACAGATGGGCCAAGGTTGCTCGG No data
1124542147_1124542155 17 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data
1124542147_1124542151 2 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542151 15:30596642-30596664 TTTTCTCTCCGTTTACAGATGGG No data
1124542147_1124542152 8 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542147 Original CRISPR GGCTCTGAAGAGAAGAGTCA GGG (reversed) Intergenic
No off target data available for this crispr