ID: 1124542149

View in Genome Browser
Species Human (GRCh38)
Location 15:30596638-30596660
Sequence TCTGTAAACGGAGAGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542149_1124542156 3 Left 1124542149 15:30596638-30596660 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data
1124542149_1124542154 -5 Left 1124542149 15:30596638-30596660 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124542154 15:30596656-30596678 ACAGATGGGCCAAGGTTGCTCGG No data
1124542149_1124542155 -4 Left 1124542149 15:30596638-30596660 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data
1124542149_1124542158 11 Left 1124542149 15:30596638-30596660 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124542158 15:30596672-30596694 TGCTCGGGTGATTGGTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542149 Original CRISPR TCTGTAAACGGAGAGAAAAC AGG (reversed) Intergenic
No off target data available for this crispr