ID: 1124542153

View in Genome Browser
Species Human (GRCh38)
Location 15:30596650-30596672
Sequence AACCTTGGCCCATCTGTAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542153_1124542158 -1 Left 1124542153 15:30596650-30596672 CCGTTTACAGATGGGCCAAGGTT No data
Right 1124542158 15:30596672-30596694 TGCTCGGGTGATTGGTTTACTGG No data
1124542153_1124542159 23 Left 1124542153 15:30596650-30596672 CCGTTTACAGATGGGCCAAGGTT No data
Right 1124542159 15:30596696-30596718 TTCGCACAAAACTGATCTCCAGG No data
1124542153_1124542156 -9 Left 1124542153 15:30596650-30596672 CCGTTTACAGATGGGCCAAGGTT No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542153 Original CRISPR AACCTTGGCCCATCTGTAAA CGG (reversed) Intergenic
No off target data available for this crispr