ID: 1124542155

View in Genome Browser
Species Human (GRCh38)
Location 15:30596657-30596679
Sequence CAGATGGGCCAAGGTTGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542149_1124542155 -4 Left 1124542149 15:30596638-30596660 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data
1124542148_1124542155 16 Left 1124542148 15:30596618-30596640 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data
1124542147_1124542155 17 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data
1124542146_1124542155 24 Left 1124542146 15:30596610-30596632 CCTCAGTCCCTGACTCTTCTCTT No data
Right 1124542155 15:30596657-30596679 CAGATGGGCCAAGGTTGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542155 Original CRISPR CAGATGGGCCAAGGTTGCTC GGG Intergenic
No off target data available for this crispr