ID: 1124542156

View in Genome Browser
Species Human (GRCh38)
Location 15:30596664-30596686
Sequence GCCAAGGTTGCTCGGGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542153_1124542156 -9 Left 1124542153 15:30596650-30596672 CCGTTTACAGATGGGCCAAGGTT No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data
1124542147_1124542156 24 Left 1124542147 15:30596617-30596639 CCCTGACTCTTCTCTTCAGAGCC No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data
1124542148_1124542156 23 Left 1124542148 15:30596618-30596640 CCTGACTCTTCTCTTCAGAGCCT No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data
1124542149_1124542156 3 Left 1124542149 15:30596638-30596660 CCTGTTTTCTCTCCGTTTACAGA No data
Right 1124542156 15:30596664-30596686 GCCAAGGTTGCTCGGGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542156 Original CRISPR GCCAAGGTTGCTCGGGTGAT TGG Intergenic
No off target data available for this crispr