ID: 1124542817

View in Genome Browser
Species Human (GRCh38)
Location 15:30603799-30603821
Sequence CCCACTCTGGAAGAGAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542817_1124542826 6 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542826 15:30603828-30603850 CTCCCCTCTCTTAGAGTGGGTGG No data
1124542817_1124542833 24 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542833 15:30603846-30603868 GGTGGGGAGAGCGGTTGCCATGG No data
1124542817_1124542827 7 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542827 15:30603829-30603851 TCCCCTCTCTTAGAGTGGGTGGG No data
1124542817_1124542825 3 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542825 15:30603825-30603847 CCTCTCCCCTCTCTTAGAGTGGG No data
1124542817_1124542823 2 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542823 15:30603824-30603846 GCCTCTCCCCTCTCTTAGAGTGG No data
1124542817_1124542834 25 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542817_1124542832 15 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542832 15:30603837-30603859 CTTAGAGTGGGTGGGGAGAGCGG No data
1124542817_1124542829 8 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542829 15:30603830-30603852 CCCCTCTCTTAGAGTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542817 Original CRISPR CCCACTCTGGAAGAGAAGAG GGG (reversed) Intergenic
No off target data available for this crispr