ID: 1124542832

View in Genome Browser
Species Human (GRCh38)
Location 15:30603837-30603859
Sequence CTTAGAGTGGGTGGGGAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542817_1124542832 15 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542832 15:30603837-30603859 CTTAGAGTGGGTGGGGAGAGCGG No data
1124542819_1124542832 14 Left 1124542819 15:30603800-30603822 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124542832 15:30603837-30603859 CTTAGAGTGGGTGGGGAGAGCGG No data
1124542820_1124542832 13 Left 1124542820 15:30603801-30603823 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124542832 15:30603837-30603859 CTTAGAGTGGGTGGGGAGAGCGG No data
1124542822_1124542832 2 Left 1124542822 15:30603812-30603834 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124542832 15:30603837-30603859 CTTAGAGTGGGTGGGGAGAGCGG No data
1124542815_1124542832 19 Left 1124542815 15:30603795-30603817 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124542832 15:30603837-30603859 CTTAGAGTGGGTGGGGAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542832 Original CRISPR CTTAGAGTGGGTGGGGAGAG CGG Intergenic
No off target data available for this crispr