ID: 1124542834

View in Genome Browser
Species Human (GRCh38)
Location 15:30603847-30603869
Sequence GTGGGGAGAGCGGTTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124542817_1124542834 25 Left 1124542817 15:30603799-30603821 CCCCTCTTCTCTTCCAGAGTGGG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542824_1124542834 -1 Left 1124542824 15:30603825-30603847 CCTCTCCCCTCTCTTAGAGTGGG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542828_1124542834 -6 Left 1124542828 15:30603830-30603852 CCCCTCTCTTAGAGTGGGTGGGG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542831_1124542834 -8 Left 1124542831 15:30603832-30603854 CCTCTCTTAGAGTGGGTGGGGAG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542822_1124542834 12 Left 1124542822 15:30603812-30603834 CCAGAGTGGGAGGCCTCTCCCCT No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542830_1124542834 -7 Left 1124542830 15:30603831-30603853 CCCTCTCTTAGAGTGGGTGGGGA No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542820_1124542834 23 Left 1124542820 15:30603801-30603823 CCTCTTCTCTTCCAGAGTGGGAG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542819_1124542834 24 Left 1124542819 15:30603800-30603822 CCCTCTTCTCTTCCAGAGTGGGA No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data
1124542815_1124542834 29 Left 1124542815 15:30603795-30603817 CCGGCCCCTCTTCTCTTCCAGAG No data
Right 1124542834 15:30603847-30603869 GTGGGGAGAGCGGTTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124542834 Original CRISPR GTGGGGAGAGCGGTTGCCAT GGG Intergenic
No off target data available for this crispr