ID: 1124543437

View in Genome Browser
Species Human (GRCh38)
Location 15:30607426-30607448
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 16, 1: 5, 2: 0, 3: 17, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124543437_1124543439 -9 Left 1124543437 15:30607426-30607448 CCTCTTGGGGAAGTGCTAGCCTG 0: 16
1: 5
2: 0
3: 17
4: 142
Right 1124543439 15:30607440-30607462 GCTAGCCTGACTGGTTGTCAAGG 0: 20
1: 16
2: 1
3: 6
4: 89
1124543437_1124543440 -8 Left 1124543437 15:30607426-30607448 CCTCTTGGGGAAGTGCTAGCCTG 0: 16
1: 5
2: 0
3: 17
4: 142
Right 1124543440 15:30607441-30607463 CTAGCCTGACTGGTTGTCAAGGG 0: 8
1: 23
2: 6
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124543437 Original CRISPR CAGGCTAGCACTTCCCCAAG AGG (reversed) Intronic
901128452 1:6946065-6946087 CAGGCTGGCAGTTCCTCAAAAGG - Intronic
902197001 1:14805209-14805231 CAGGGTAGCTCTGCCCCATGAGG + Intronic
903332607 1:22603640-22603662 GAGGCTGGCCCTTCCCCAACAGG - Intergenic
903574034 1:24326760-24326782 ATGGCTAGCACTTTCTCAAGAGG - Intronic
906021794 1:42635842-42635864 CAGCCTGGCAGTTCCTCAAGTGG - Intronic
917537963 1:175888116-175888138 CAGGCTGACACTGCCCCTAGTGG + Intergenic
920147958 1:203878996-203879018 CAAGCTAGCACATCACCAGGGGG - Intergenic
922113140 1:222582528-222582550 CAGTCTGGCAGTTCCTCAAGAGG + Intronic
923882802 1:238122187-238122209 TGGGCTAGCAGTTCCCCACGAGG + Intergenic
1065124329 10:22559720-22559742 CAGGCCAGGACTTCTCCAAGTGG + Intronic
1065231524 10:23603471-23603493 CAGACTAGCACTTACCAATGAGG + Intergenic
1066178745 10:32939056-32939078 CAGGACAGCACTTCTCTAAGTGG + Intronic
1069939903 10:71948243-71948265 CAGGCTAGCACAACTCCAGGGGG - Intergenic
1071559327 10:86632860-86632882 CAGGCAAGAGCTTTCCCAAGTGG - Intergenic
1076200653 10:128555024-128555046 CAGGGTCCCACTCCCCCAAGTGG - Intergenic
1078353387 11:10614181-10614203 CACCCTAGCCCTTCCCCAAGGGG + Intronic
1079824833 11:25177900-25177922 TAGCCTAGCATTTCCCCAAGAGG - Intergenic
1083256935 11:61502370-61502392 CAGGTTAGCTCATCTCCAAGTGG + Intergenic
1083888469 11:65584164-65584186 CAGGCATGAGCTTCCCCAAGAGG + Intronic
1087279656 11:96196401-96196423 CAAGATAGCATTTCCCCAAGAGG - Intronic
1089150110 11:116357821-116357843 CAGGGTCGCACTCCCCAAAGTGG + Intergenic
1090832581 11:130429324-130429346 GAAGTTAGCATTTCCCCAAGAGG + Intergenic
1091392658 12:135252-135274 CAGGAAAGTCCTTCCCCAAGGGG - Intronic
1091614888 12:2042863-2042885 CATGCTAACAATTTCCCAAGTGG - Intronic
1095502860 12:42859818-42859840 CAAGCTGGCAGTGCCCCAAGAGG + Intergenic
1098996400 12:77125729-77125751 CAGGCTGGCAGTTCCTCAAATGG + Intergenic
1101798519 12:108000553-108000575 CAGGGCACCAATTCCCCAAGGGG + Intergenic
1101964775 12:109274887-109274909 CAGGCCAGGCCATCCCCAAGGGG - Intergenic
1103338861 12:120210594-120210616 CACCCTAGATCTTCCCCAAGAGG - Exonic
1103831711 12:123785142-123785164 CAGTCTAGAAATTCCTCAAGAGG - Intronic
1104835015 12:131784061-131784083 GATGCTTGCAGTTCCCCAAGTGG + Intronic
1107528554 13:41259199-41259221 CAGTCTAGCACTTCCTCAAAAGG + Intronic
1108058865 13:46512987-46513009 CAGGCTGGCAGTTCCTCAAAAGG - Intergenic
1110171149 13:72502071-72502093 CAGACTGGTACATCCCCAAGAGG + Intergenic
1110623954 13:77630592-77630614 CAGTCTAGCAGTTCCTCAAATGG - Intronic
1112572372 13:100605560-100605582 CAAGCTATTACTTCCCCAAATGG - Intronic
1115645836 14:35367984-35368006 CAGGCCACCTCTTCCCCAGGAGG + Intergenic
1116690262 14:48097243-48097265 CATGCAAGCACTTCCACAAAGGG - Intergenic
1117049474 14:51845816-51845838 CAGGCCAGCACGTCCCAAACTGG - Intronic
1117861143 14:60093748-60093770 CAGTCTAGCAGTTCCTCAAAAGG - Intronic
1118874961 14:69776267-69776289 CAGCCTAGCCCTTCCCCTGGTGG - Exonic
1123472494 15:20565498-20565520 CAGGCTAGCACTTCCCCAAGAGG - Intergenic
1123645510 15:22434855-22434877 CAGGCTAGCACTTCCCCAAGAGG + Intergenic
1123666762 15:22614422-22614444 CAGGCTAGCACTTCCCCAAGAGG + Intergenic
1123732799 15:23160489-23160511 CAGGCTAGCACTTCCCCAAGAGG - Intergenic
1123750933 15:23357869-23357891 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124283304 15:28381785-28381807 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124299395 15:28529828-28529850 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124320602 15:28708995-28709017 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124481891 15:30086354-30086376 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124488347 15:30138452-30138474 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124521701 15:30410847-30410869 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124536963 15:30555372-30555394 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124543437 15:30607426-30607448 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124563394 15:30794877-30794899 CAGGCTAGTAATTCCCCGAGAGG - Intergenic
1124755180 15:32399868-32399890 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124761688 15:32452219-32452241 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124776940 15:32596849-32596871 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124959887 15:34386353-34386375 CAGGCCAGCACTTCCCCAAGAGG + Intronic
1124976514 15:34532574-34532596 CAGGCCAGCACTTCCCCAAGAGG + Intronic
1127775564 15:62261864-62261886 CAGACTAGCACTTCCCCAAGAGG + Intergenic
1128820318 15:70646436-70646458 CAGGGTTGCACTTCCTCTAGAGG - Intergenic
1129029454 15:72607849-72607871 CAGGCTAGCGCTTCCCTGAGAGG - Intergenic
1129037392 15:72658893-72658915 CAGGCTAGCGCTTCCCTGAGAGG - Intronic
1129212495 15:74078332-74078354 CAGGCTAGCGCTTCCCTGAGAGG + Intronic
1129397904 15:75262747-75262769 CAGGCTAGCGCTTCCCTGAGAGG - Intronic
1129401515 15:75287028-75287050 CAGGCTAGCGCTTCCCTGAGAGG - Intronic
1129445402 15:75613864-75613886 CAGTCTAGCACTTCCTCAAAAGG + Intronic
1129729629 15:77922651-77922673 CAGGCTAGCGCTTCCCTGAGAGG + Intergenic
1129838896 15:78731328-78731350 CAGGCTAGTGCTTCCCTGAGAGG - Intergenic
1130259826 15:82346284-82346306 CAGGCTAGTGCTTCCCAGAGAGG + Intronic
1130268898 15:82433152-82433174 CAGGCTAGTGCTTCCCAGAGAGG - Intronic
1130281405 15:82522725-82522747 CAGGCTAGTGCTTCCCAGAGAGG - Intergenic
1130472778 15:84238908-84238930 CAGGCTAGTGCTTCCCAGAGAGG - Intronic
1130480269 15:84353479-84353501 CAGGCTAGTGCTTCCCAGAGAGG - Intergenic
1130491500 15:84434650-84434672 CAGGCTAGTGCTTCCCAGAGAGG + Intergenic
1130503115 15:84513690-84513712 CAGGCTAGTGCTTCCCAGAGAGG + Intergenic
1130595073 15:85243542-85243564 CAGGCTAGTGCTTCCCAGAGAGG - Intergenic
1131033965 15:89208995-89209017 GAAGCCAGCACTTACCCAAGAGG + Intergenic
1132040544 15:98521801-98521823 CTGGCTGGCATGTCCCCAAGTGG + Intergenic
1132433482 15:101778825-101778847 CAGGCTAGCACTTCCCCGAGAGG + Intergenic
1135378314 16:21970348-21970370 CAGTCTGGCAGTTCCCCAAATGG - Intronic
1138316612 16:56075798-56075820 AAGGCATGGACTTCCCCAAGAGG - Intergenic
1138545246 16:57715188-57715210 CAGGCATGCACTACCACAAGTGG + Intronic
1142068074 16:88074097-88074119 CAGGCTAGCTCTGCCCCACTGGG + Intronic
1145413360 17:22693155-22693177 CAGGCTTGCAATTGCCCCAGTGG + Intergenic
1149985659 17:61345028-61345050 CAGGCGAGCTCTGCCCCAGGCGG - Intronic
1150600784 17:66649234-66649256 TTGGCAAGCACTGCCCCAAGGGG - Intronic
1151484444 17:74389669-74389691 CAGGCCTGCCCTTCCCTAAGAGG + Intergenic
1151574130 17:74943045-74943067 CAAGAAAGCACTTCCCCAAAGGG + Intronic
1157548254 18:48563078-48563100 CAGGCTCCCACCTGCCCAAGAGG - Intronic
1159219623 18:65442338-65442360 CAGACTAGCAATTCCAAAAGAGG - Intergenic
1160436357 18:78855561-78855583 CCAGTTAGCACTTCCCCCAGTGG - Intergenic
1160436369 18:78855610-78855632 CCAGTTAGCACTTCCCCCAGTGG - Intergenic
1160436403 18:78855757-78855779 CCAGTTAGCACTTCCCCCAGTGG - Intergenic
1163155499 19:15438035-15438057 CATACTGGCACCTCCCCAAGTGG + Intronic
1163927324 19:20358218-20358240 CAGGCTATCACTTCCCGGTGTGG + Intergenic
1165133523 19:33648640-33648662 CGGTCTAGCAATTCCTCAAGAGG + Intronic
1166167586 19:41003170-41003192 CTGCCCAGCAGTTCCCCAAGTGG + Intronic
1167414214 19:49361859-49361881 CAGCCCAGCCCTTCCCCATGTGG + Intronic
925957981 2:8986835-8986857 CACGCGAGCACACCCCCAAGTGG + Intronic
928049981 2:27981914-27981936 CAGTCTGGCAGTTCCTCAAGAGG - Intronic
929174169 2:38960219-38960241 CAGGCGAGCAGTTCTCGAAGAGG - Exonic
930616195 2:53596942-53596964 CAGGCTCCAACTTTCCCAAGAGG + Intronic
931738590 2:65221306-65221328 CAGTCTTGCAGTTCCCCAAAAGG - Intergenic
932078984 2:68694278-68694300 CAGGCTACGACTTCACAAAGCGG - Intronic
933631044 2:84658375-84658397 CAGCCAAGCAATTCCACAAGTGG + Exonic
933658420 2:84907242-84907264 CAGTCTAGCACTTCCTCTAATGG - Intergenic
936865705 2:117074199-117074221 GATGCTGGCACTTCCCCATGTGG + Intergenic
942262776 2:174186556-174186578 CAGGCAAGCACATCCACAAAGGG + Intronic
944813349 2:203349954-203349976 CAGGCTGGCAGTTCCTCAAATGG - Intronic
945294832 2:208160363-208160385 CAGGCTTGCCCTTCTCCACGTGG + Intergenic
946203947 2:218089892-218089914 GCAGCTGGCACTTCCCCAAGTGG - Exonic
947793223 2:232879386-232879408 CAGGCCAGCACCTCCCCAGGTGG - Exonic
948049303 2:234967548-234967570 CAGCCTTGCACTTCCCTAAGTGG + Intronic
1174396549 20:50250437-50250459 GGGGCTAGCTCTACCCCAAGGGG + Intergenic
1175371596 20:58496333-58496355 CAGGCTGGCACCTGCCCATGAGG - Intronic
1178204479 21:30447451-30447473 CAGCCTTGCACTTCCCAAACAGG + Intergenic
1185128690 22:49025606-49025628 CAGGCCAGCCCTTCCCCTGGGGG + Intergenic
949748587 3:7324982-7325004 CAGGCTAGCACTTTCTCAGTTGG + Intronic
952764818 3:36944844-36944866 CAGGGAAGCGCTTCCCCAGGCGG - Exonic
954801870 3:53191925-53191947 GAGGCTGCCATTTCCCCAAGAGG - Intronic
954812248 3:53255569-53255591 CAGGCCGGCTCTTCCCCACGCGG - Intronic
955599109 3:60625346-60625368 CAGTCTATCATTTCCCCAAAAGG - Intronic
958998752 3:100937268-100937290 CTGGCAAGCATTTTCCCAAGTGG - Intronic
961211745 3:125130948-125130970 CAGGTTAGCATTTACCCTAGAGG - Intronic
961871918 3:129994587-129994609 CAGGTTAGCAATTCCTAAAGTGG - Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
968491728 4:893777-893799 CAGGTGAGCAGTGCCCCAAGGGG + Intronic
970447517 4:16136516-16136538 CAGGCTAGCAGCTGCCCAGGAGG + Intergenic
971843494 4:31887833-31887855 CAGGCAAACACTACCCCAAAGGG - Intergenic
973643108 4:52922766-52922788 CAGCTTAGCACTTCCTCAAAAGG - Intronic
977143344 4:93403810-93403832 CAGTCTAGCAGTTCCTCAAATGG + Intronic
978251007 4:106631529-106631551 CAGGCTACCACTTCCCAAGCTGG - Intergenic
985122255 4:186655972-186655994 CAGTTTGGTACTTCCCCAAGAGG + Intronic
985241582 4:187936401-187936423 CAGTCTAGCAATTCCCCAAATGG + Intergenic
990170008 5:53037575-53037597 GAGGCTAGGACATCACCAAGAGG - Intronic
993042624 5:82832597-82832619 CAGTTTAGCACTTTCTCAAGTGG + Intergenic
997237037 5:132278658-132278680 CAAGCTAGCACACCCCCTAGAGG - Intronic
997753704 5:136374668-136374690 GAGGATAACACTTTCCCAAGAGG + Intronic
1002182642 5:177438912-177438934 CAGTCTGGCAGTTCCCCAAAAGG - Intronic
1002342536 5:178526435-178526457 CAGGCAAACACTTCCCCACCAGG - Intronic
1003312944 6:4985252-4985274 CAGCCCATCACTTCCCCAGGGGG - Intergenic
1004472952 6:15945504-15945526 AAAGCTAGAACTTCCCCTAGAGG + Intergenic
1004540686 6:16546990-16547012 GATGCTAGAACTTCCCCAAGGGG - Intronic
1006818177 6:36867742-36867764 GAGGCTAGCCCTCCCACAAGGGG + Intronic
1006935899 6:37717468-37717490 CAGGGTACCACCTCCCCAGGTGG - Intergenic
1006986202 6:38177329-38177351 CAGGCCAGCTCTTCCCCCACCGG + Intronic
1010749091 6:79598175-79598197 TAGTCTAGCAGTTCCTCAAGAGG + Intergenic
1015925343 6:138303978-138304000 CAGGCTGACAGTTCCTCAAGGGG + Intronic
1017104557 6:150875380-150875402 CAGGCTGGCACCTCCCTCAGAGG + Intronic
1017409122 6:154150424-154150446 CAGACTAGCCCTTCCCCCATTGG + Intronic
1023898786 7:44457914-44457936 CAGCCTGGCACTTCCTCAAAAGG + Intronic
1025029085 7:55541544-55541566 CAGTCTAGCAGTTCCTCAAAAGG + Intronic
1027669460 7:81077832-81077854 CAAGCTCCCACTTCCTCAAGGGG - Intergenic
1030927600 7:115477402-115477424 CAGGCTTGCACTCCCCAAAAAGG + Intergenic
1032202100 7:129829327-129829349 CAGTCTAGCTGTTTCCCAAGTGG - Intergenic
1035868679 8:3113000-3113022 CACGTTTGCATTTCCCCAAGTGG + Intronic
1036509697 8:9388859-9388881 CAGGGTTGCACTTTCCCCAGAGG - Intergenic
1038456210 8:27673390-27673412 CAGGCCAGACCTGCCCCAAGGGG + Intronic
1042117006 8:65443204-65443226 CCCCCTAGCAGTTCCCCAAGTGG + Intergenic
1042955838 8:74249961-74249983 CAGGCTGGCTCTCTCCCAAGAGG + Intronic
1043409025 8:79972545-79972567 CAGTTTGGCAGTTCCCCAAGTGG - Intronic
1048981545 8:139705389-139705411 CAGGCTAGCAGCTGGCCAAGGGG + Intergenic
1048997547 8:139803808-139803830 CACTTTACCACTTCCCCAAGAGG + Intronic
1049010445 8:139883838-139883860 GAGGCTGGCACTTGCCCCAGGGG - Intronic
1052489085 9:29140072-29140094 CAGGAAAGACCTTCCCCAAGAGG - Intergenic
1056001659 9:82223696-82223718 CAGTCTGGCAGTTCCTCAAGAGG + Intergenic
1056883767 9:90420397-90420419 CAGGTGAGCAGTGCCCCAAGAGG - Intergenic
1057690969 9:97284885-97284907 CAGTCTAGCAGTTCTCCAAAAGG - Intergenic
1061064109 9:128266915-128266937 CAGGCTAGCGCTTCCCCAAGAGG + Intronic
1062128509 9:134879979-134880001 CAGGCCAGCTCTTCTCCAAAAGG + Intergenic
1185741825 X:2539723-2539745 CAGGCTTTCAGTTCTCCAAGTGG + Intergenic
1186361479 X:8846490-8846512 CAGGCTGGCACTTGGCAAAGAGG - Intergenic
1188138134 X:26514833-26514855 CTGGCTGGCCCTTCACCAAGAGG + Intergenic
1192601702 X:72471396-72471418 CAGTCTAGCTCTTCCTCAAATGG - Intronic
1199702438 X:150392504-150392526 CATGCTACCACTTCCCCATCAGG - Intronic
1200245512 X:154522163-154522185 CAGGCCACCCCTTCACCAAGGGG + Intergenic
1202366809 Y:24171236-24171258 CAGGCTAGTGCTTCCCTGAGAGG - Intergenic
1202503973 Y:25498887-25498909 CAGGCTAGTGCTTCCCTGAGAGG + Intergenic