ID: 1124545845

View in Genome Browser
Species Human (GRCh38)
Location 15:30626121-30626143
Sequence GACACCCGGAGCCACCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 0, 3: 5, 4: 92}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124545845_1124545854 -6 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545854 15:30626138-30626160 GGTGTCTGCAGTGGAGCTGGGGG 0: 1
1: 0
2: 7
3: 46
4: 468
1124545845_1124545852 -8 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545852 15:30626136-30626158 CGGGTGTCTGCAGTGGAGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 197
1124545845_1124545858 19 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545858 15:30626163-30626185 GAAGCATGAGGCTAACGGCTTGG 0: 2
1: 0
2: 0
3: 4
4: 77
1124545845_1124545855 -3 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545855 15:30626141-30626163 GTCTGCAGTGGAGCTGGGGGCGG 0: 1
1: 0
2: 7
3: 119
4: 1423
1124545845_1124545853 -7 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545853 15:30626137-30626159 GGGTGTCTGCAGTGGAGCTGGGG 0: 1
1: 0
2: 4
3: 39
4: 377
1124545845_1124545857 14 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545857 15:30626158-30626180 GGGCGGAAGCATGAGGCTAACGG 0: 2
1: 0
2: 0
3: 6
4: 100
1124545845_1124545851 -9 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545851 15:30626135-30626157 CCGGGTGTCTGCAGTGGAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 257
1124545845_1124545856 7 Left 1124545845 15:30626121-30626143 CCCCCGTGGTGGCTCCGGGTGTC 0: 1
1: 1
2: 0
3: 5
4: 92
Right 1124545856 15:30626151-30626173 GAGCTGGGGGCGGAAGCATGAGG 0: 2
1: 0
2: 0
3: 44
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124545845 Original CRISPR GACACCCGGAGCCACCACGG GGG (reversed) Intronic
900439024 1:2644184-2644206 GACCCCCGGGCCCACCACTGGGG - Intronic
900551064 1:3255853-3255875 GACACCCGAAGCCAACCCCGTGG + Intronic
900551072 1:3255883-3255905 GACACCCGAAGCCAACCCCGTGG + Intronic
900986522 1:6076375-6076397 GCCTGTCGGAGCCACCACGGTGG + Intronic
901204043 1:7483832-7483854 GACTCCAGGAGCCACCCCTGGGG - Intronic
903266923 1:22163266-22163288 GACAGCTGTAGCCACCCCGGGGG - Intergenic
905665774 1:39762095-39762117 GACACCTGGAGCCACCTCCTTGG - Intronic
921070904 1:211656839-211656861 GAGGCCCTGAGCCACCACGCAGG - Intergenic
922689204 1:227674032-227674054 GACACTGGCAGCCACCTCGGTGG - Intronic
1065023898 10:21523705-21523727 GAAATCCTGAGCCACCACGAGGG + Exonic
1066602580 10:37124770-37124792 GACACTCAGTGCCACCGCGGAGG + Intergenic
1075780191 10:125012395-125012417 GACACTCTCAGCCACCACTGTGG + Intronic
1076356653 10:129858208-129858230 GTCACCGGCAGACACCACGGAGG - Intronic
1077338945 11:2017555-2017577 GACACCCCCAGACCCCACGGGGG - Intergenic
1083720210 11:64600161-64600183 GACACCCAGAGCCAGCCCCGAGG - Intronic
1083778853 11:64907722-64907744 GAGACCCGGGGCCAGCAGGGCGG - Intronic
1084661088 11:70546766-70546788 GACACCCAGAGCCAGCAGGGAGG - Intronic
1085449715 11:76624603-76624625 GTCACCCAGATCCACCACCGCGG + Intergenic
1090076128 11:123581070-123581092 GACTCCCGGAGCCTTCGCGGTGG + Intronic
1090398495 11:126434258-126434280 GGCACCAGGAGCCACCGAGGGGG + Intronic
1202821929 11_KI270721v1_random:72737-72759 GACACCCCCAGACCCCACGGGGG - Intergenic
1093448885 12:19292595-19292617 CACACCTGGTGCCACCACTGAGG - Intronic
1104970852 12:132529978-132530000 GACACCCACAGCCACCTCTGAGG - Intronic
1105005609 12:132718852-132718874 GACACCCCGAGCCGTCACGCTGG - Intronic
1107557018 13:41525239-41525261 GACAGCAGGAGCCACCACTGAGG - Intergenic
1108059600 13:46519401-46519423 GAAACCTGGAGCCATCAAGGGGG + Intergenic
1116872536 14:50082000-50082022 GACCACCGGCGCCATCACGGTGG - Intergenic
1122768037 14:104085199-104085221 AACACCCAGGGCCGCCACGGAGG + Intergenic
1124545845 15:30626121-30626143 GACACCCGGAGCCACCACGGGGG - Intronic
1124779363 15:32615508-32615530 GACACCCAGAGCCACCACGGGGG - Exonic
1128162263 15:65431373-65431395 GATAACCGAAGCCACCACCGTGG + Intergenic
1132770605 16:1560580-1560602 TGCACCAGCAGCCACCACGGTGG - Intronic
1136778847 16:32885147-32885169 AACCCCCGGAGCCGCCGCGGAGG - Intergenic
1136891771 16:33976371-33976393 AACCCCCGGAGCCGCCGCGGAGG + Intergenic
1139666530 16:68460748-68460770 GAGACCAGGAGCCACCATGATGG - Intergenic
1142155281 16:88530141-88530163 GGCACCCCGAGACACTACGGGGG - Intronic
1146602868 17:34233873-34233895 GATACCCAGACCCACCACTGTGG + Intergenic
1147189333 17:38729928-38729950 CACACCCGGGCCCACCACGCAGG + Intergenic
1147215035 17:38894037-38894059 GACACCTGGAGCCTCCCCTGTGG + Intronic
1147325489 17:39667753-39667775 GGCCCCCGGAGCGACCACAGCGG + Intergenic
1147442981 17:40458672-40458694 GTCTCCCTGAGGCACCACGGCGG + Intergenic
1148013391 17:44503585-44503607 GCGACCCGGAGCGACCCCGGTGG + Intergenic
1148153901 17:45411913-45411935 GAAACTCTGAGCCACCAGGGAGG + Intronic
1150009066 17:61488083-61488105 GAAACGGGGGGCCACCACGGGGG - Intergenic
1152897052 17:82918107-82918129 CATACCCGGAGTCACCGCGGAGG - Intronic
1154206875 18:12345081-12345103 AACACCCGGAGCTACCTAGGTGG + Intronic
1157578068 18:48757115-48757137 GACACACAGAGACACCAGGGAGG - Intronic
1161028929 19:2049125-2049147 GACGGCCGCAGCCACCACAGCGG + Intronic
1163640255 19:18458021-18458043 GACACCCTGGGGCACCACGTGGG + Intronic
1164429208 19:28172280-28172302 GAGACCCCGAGCCAACACAGGGG - Intergenic
1166268929 19:41701674-41701696 GAGACCTGGAGCCACCCCAGGGG - Intronic
1167117757 19:47498039-47498061 CCCACCCAGAGCCACCAAGGTGG + Intronic
929963885 2:46519159-46519181 GGCACCCGGGGCCATGACGGGGG + Exonic
933764111 2:85695472-85695494 CACCCCAGGAGCCACCAGGGAGG - Intronic
934763937 2:96870041-96870063 GGCTCCCCGCGCCACCACGGCGG + Intronic
936340127 2:111623673-111623695 GACTCCTGGAGACACCATGGAGG - Intergenic
938305520 2:130251940-130251962 GACTCCGGGAGCCACCACCTGGG - Intergenic
945225889 2:207530512-207530534 GGAACCCGGAGCCGCCCCGGGGG + Intronic
948861718 2:240755814-240755836 GACACCCGGAGCCACTCCTGGGG + Intronic
1171962262 20:31503342-31503364 GCCTCCCAAAGCCACCACGGTGG + Intergenic
1175488555 20:59363303-59363325 GATACCCCCACCCACCACGGAGG + Intergenic
1178629114 21:34243848-34243870 GACACCTGGAAGCACCAAGGTGG - Intergenic
1179508771 21:41858661-41858683 GAGACAAGGAGCCAGCACGGAGG + Intronic
1179780023 21:43693539-43693561 GACGCCCGCAGCCACTACAGAGG - Exonic
1182143546 22:27982864-27982886 GACAGCCCGAGCCAGCACAGTGG - Exonic
1182443980 22:30379800-30379822 AGCACCCGGAGCCACTACAGGGG + Exonic
1184749063 22:46473736-46473758 GCCACCAGGAGCCACCAAGCAGG - Intronic
1185069509 22:48648319-48648341 GGCATCCGGAGCCCCCACAGGGG - Intronic
953694578 3:45147330-45147352 GTCACCCGGAGCAACCTGGGAGG + Intergenic
953904135 3:46859888-46859910 GCTGCCCTGAGCCACCACGGAGG + Intronic
956774085 3:72550461-72550483 GACACCCAGAGACACAGCGGCGG - Intergenic
958814433 3:98901065-98901087 GAGACCCGCAGCCCCGACGGAGG + Intronic
961825692 3:129597942-129597964 CTCACCCGGAGCCCCCACTGTGG - Intronic
968495434 4:912699-912721 GGAACCAGGAGCCAGCACGGTGG - Intronic
969251901 4:5973665-5973687 GACTCCCGGAGCCAGGAAGGTGG + Exonic
985524249 5:394116-394138 GAAACCCAGAGCCAGCAGGGTGG - Intronic
999702992 5:154245180-154245202 GACAACTAGAGCCACCATGGTGG + Intronic
1000360140 5:160439362-160439384 AACAGCCAAAGCCACCACGGAGG - Intergenic
1009644336 6:66378094-66378116 CACACCCTGAGCCCCCACAGTGG + Intergenic
1018238861 6:161753263-161753285 GACAGAAGGAGCCACCACCGAGG + Intronic
1018635036 6:165853946-165853968 GGCTCTGGGAGCCACCACGGTGG + Intronic
1018986236 6:168639185-168639207 GCCACCCAGAGCCAAAACGGGGG - Intronic
1019188934 6:170238757-170238779 GACACCCGGAGAACCCACTGTGG - Intergenic
1019345760 7:529979-530001 GGCACCAGGAGCCACCAGTGTGG + Intergenic
1024041433 7:45559112-45559134 GACAACTGGAGCCACCACTTTGG - Intergenic
1029619991 7:101684434-101684456 GACACCCGCAGCCGCCAGGCTGG + Intergenic
1033303036 7:140203072-140203094 AACACCCGGCCCCACCAGGGCGG + Intergenic
1034441489 7:151087907-151087929 GGCACCCGCAGGCACCCCGGTGG + Intronic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1036709163 8:11067324-11067346 GACACCTGGAGCAGCCACTGTGG + Intronic
1040963976 8:53065557-53065579 GACTCCCGGCTCCACCCCGGCGG + Intergenic
1045113030 8:98951277-98951299 CAGACCCGCAGCCACCTCGGTGG - Intronic
1049688649 8:143949326-143949348 GCCATCCGGAGCCAGCACGGAGG + Intronic
1049813818 8:144588702-144588724 CACAGCCGGAGGCAGCACGGCGG + Intronic
1056836894 9:89962739-89962761 GCCACCCTGAGCCACTAAGGGGG - Intergenic
1057335527 9:94152129-94152151 GACTCCCCGAGCAACCCCGGAGG + Intergenic
1061767101 9:132888327-132888349 GAGGCCCGGAACCACTACGGCGG + Exonic
1200100951 X:153688893-153688915 GACCCCCGGAGCCGCCGCGGAGG + Intronic
1200115840 X:153769371-153769393 GAGACTCAGGGCCACCACGGAGG + Intronic