ID: 1124546771

View in Genome Browser
Species Human (GRCh38)
Location 15:30635961-30635983
Sequence GCATCCTTCTCATCTAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124546771_1124546774 0 Left 1124546771 15:30635961-30635983 CCTATTCTAGATGAGAAGGATGC 0: 2
1: 0
2: 0
3: 12
4: 130
Right 1124546774 15:30635984-30636006 TATGAAGAAAGGTTTGTGTAGGG 0: 2
1: 0
2: 1
3: 25
4: 309
1124546771_1124546773 -1 Left 1124546771 15:30635961-30635983 CCTATTCTAGATGAGAAGGATGC 0: 2
1: 0
2: 0
3: 12
4: 130
Right 1124546773 15:30635983-30636005 CTATGAAGAAAGGTTTGTGTAGG 0: 2
1: 0
2: 1
3: 26
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124546771 Original CRISPR GCATCCTTCTCATCTAGAAT AGG (reversed) Intronic