ID: 1124547113

View in Genome Browser
Species Human (GRCh38)
Location 15:30640115-30640137
Sequence GACCCAGATGTAACTATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124547113_1124547115 17 Left 1124547113 15:30640115-30640137 CCTGCTATAGTTACATCTGGGTC 0: 2
1: 0
2: 0
3: 5
4: 54
Right 1124547115 15:30640155-30640177 TGCTGTCATTTGTTGAATTGAGG 0: 2
1: 1
2: 2
3: 24
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124547113 Original CRISPR GACCCAGATGTAACTATAGC AGG (reversed) Intronic
904547501 1:31287585-31287607 GACCTAGATGTCACTGTAGTTGG - Intronic
909144826 1:71917037-71917059 GACACAGATGGAGCTATAGAGGG - Intronic
909769373 1:79401316-79401338 TATCCAGATGAAAATATAGCCGG - Intergenic
913539931 1:119809051-119809073 GCCAGAGATCTAACTATAGCAGG + Exonic
916601625 1:166298778-166298800 GACAGAGATGGAATTATAGCTGG + Intergenic
918179156 1:182070927-182070949 GACTGGGATGAAACTATAGCTGG - Intergenic
919574703 1:199293494-199293516 TAACCAGATGCAAGTATAGCTGG + Intergenic
920311820 1:205053029-205053051 GACCCAGATGTGCCTGGAGCTGG + Intronic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
924831714 1:247602899-247602921 GACACAGCAGTAACTTTAGCTGG + Intergenic
1084716116 11:70874954-70874976 GAACCACATGTAACTATAACAGG + Intronic
1089465792 11:118685531-118685553 GAACCAGACTCAACTATAGCGGG - Intergenic
1091935674 12:4432708-4432730 AACCCAGATCTATCTATAGATGG + Intronic
1097993271 12:65859335-65859357 GACACACATGTAACAAGAGCAGG - Exonic
1099753298 12:86806414-86806436 CACACAGATGTAAGTAAAGCTGG - Intronic
1120939434 14:89933020-89933042 TAGCCAGATGTCACTATGGCAGG + Intronic
1121454944 14:94032188-94032210 GTCCCAGATGTAATTATTGGGGG - Intronic
1124547113 15:30640115-30640137 GACCCAGATGTAACTATAGCAGG - Intronic
1124780712 15:32630077-32630099 GACCCAGATGTAACTATAGCAGG - Intronic
1126287924 15:47036551-47036573 GAATCAGATGAAACTATAACAGG + Intergenic
1131967240 15:97857480-97857502 GACCCCAAAGGAACTATAGCTGG + Intergenic
1139249448 16:65480982-65481004 GCACCAGATGTCACTATAACTGG - Intergenic
1140805635 16:78529819-78529841 GAACTATATGTAAGTATAGCTGG - Intronic
1140891316 16:79287539-79287561 GACCCACGTGTAATTAAAGCTGG + Intergenic
1155612837 18:27686545-27686567 ATCCCAAATGTAACTATGGCTGG - Intergenic
1155700994 18:28743457-28743479 GAGCCAGATGTCACTATTGCAGG + Intergenic
1163217749 19:15893507-15893529 GACCCAGGTGTAAATATACAAGG + Intronic
1164876143 19:31691688-31691710 GGCCAAGATGTAATTACAGCAGG - Intergenic
928379646 2:30806572-30806594 GACCCAACTGTAACTATAGAGGG + Intronic
930634458 2:53788795-53788817 GAATCAGATATAACTTTAGCAGG + Intronic
939221044 2:139301829-139301851 GACCCAGATGTAACCATTTCAGG + Intergenic
940507369 2:154573474-154573496 GACCCAGATGGAATTATTACTGG - Intergenic
943452930 2:188068108-188068130 GGCCTAGATGTAAATATATCAGG + Intergenic
943782522 2:191840261-191840283 GACCTAGAAGTAACTAGGGCAGG - Intronic
1168988126 20:2068460-2068482 GAACCAGATTTAGATATAGCAGG + Intergenic
1173539136 20:43838327-43838349 GACCCAGATATATCTAGCGCAGG + Intergenic
1181381694 22:22509260-22509282 GCCCCAGATGTAACTAGAAGAGG - Intergenic
950659008 3:14455105-14455127 CATGCAGATGTAACTATAGGAGG + Intronic
951414431 3:22406290-22406312 GACCAAGATGGTACTATAGCTGG + Intergenic
952624686 3:35390464-35390486 GAGCAAGATGTATCTATGGCTGG + Intergenic
955280232 3:57588238-57588260 GACCAAAGTGTTACTATAGCAGG + Intronic
959481339 3:106876269-106876291 GCCCCAGGTGTGACTATAGAAGG - Intergenic
961603609 3:128077898-128077920 GACCCACATGTAGCTGTATCAGG - Intronic
966589480 3:181665681-181665703 GGCCCAAAGGTAACTATACCTGG - Intergenic
966983295 3:185157097-185157119 AACCCAGATGTAACTGCAGTAGG + Intergenic
968276723 3:197445954-197445976 GACCCTGATGCAACCACAGCGGG + Intergenic
969110061 4:4838988-4839010 GACCCAGATGAAAAGATATCAGG + Intergenic
974743669 4:66041592-66041614 GAACCAGATACAAATATAGCAGG + Intergenic
977081154 4:92529916-92529938 CACCCATATGTAATTGTAGCCGG - Intronic
978561177 4:110035171-110035193 GAGACATATGTAACTTTAGCTGG + Intergenic
979987753 4:127336157-127336179 GTGCCTGATGTACCTATAGCAGG - Intergenic
1000731768 5:164843560-164843582 AACCCACTTGTAACTATTGCAGG - Intergenic
1002846984 6:955646-955668 GACCCAGGTGTAGGCATAGCTGG - Intergenic
1017974205 6:159340418-159340440 GACCCAAATGTTACTATTACAGG + Intergenic
1019095706 6:169577465-169577487 GTCCCAGGTGTAACCACAGCGGG + Intronic
1043235502 8:77860618-77860640 GGCCCCGATGCAACAATAGCTGG + Intergenic
1043428091 8:80168817-80168839 GACACAGAGGTTACTATGGCTGG + Intronic
1048181758 8:132201759-132201781 CACCCACATGCAACTCTAGCAGG - Intronic
1055241433 9:74191090-74191112 GACTCAGCTGTAACTCTGGCAGG + Intergenic
1195601506 X:106753982-106754004 GACCCTGATATAATAATAGCTGG + Intronic
1197039776 X:121922714-121922736 GACCCAGTTATAACTGTGGCAGG - Intergenic