ID: 1124555249

View in Genome Browser
Species Human (GRCh38)
Location 15:30719336-30719358
Sequence AGAGAGCTCAGGTTTCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 2, 1: 0, 2: 0, 3: 9, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124555249_1124555251 4 Left 1124555249 15:30719336-30719358 CCACTTGGAAACCTGAGCTCTCT 0: 2
1: 0
2: 0
3: 9
4: 192
Right 1124555251 15:30719363-30719385 TTGAGTGAGCTCCACACTCATGG 0: 1
1: 1
2: 0
3: 9
4: 124
1124555249_1124555255 28 Left 1124555249 15:30719336-30719358 CCACTTGGAAACCTGAGCTCTCT 0: 2
1: 0
2: 0
3: 9
4: 192
Right 1124555255 15:30719387-30719409 CTGTGTGCTGGAGAACCAAATGG 0: 2
1: 0
2: 2
3: 25
4: 193
1124555249_1124555253 16 Left 1124555249 15:30719336-30719358 CCACTTGGAAACCTGAGCTCTCT 0: 2
1: 0
2: 0
3: 9
4: 192
Right 1124555253 15:30719375-30719397 CACACTCATGGCCTGTGTGCTGG 0: 1
1: 1
2: 1
3: 23
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124555249 Original CRISPR AGAGAGCTCAGGTTTCCAAG TGG (reversed) Intronic