ID: 1124574304

View in Genome Browser
Species Human (GRCh38)
Location 15:30894557-30894579
Sequence CAATTCATGCTGAGCTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124574304_1124574309 -3 Left 1124574304 15:30894557-30894579 CCGTCCAAGCTCAGCATGAATTG No data
Right 1124574309 15:30894577-30894599 TTGGAGTGGGCTGCTGACTCAGG No data
1124574304_1124574310 7 Left 1124574304 15:30894557-30894579 CCGTCCAAGCTCAGCATGAATTG No data
Right 1124574310 15:30894587-30894609 CTGCTGACTCAGGCTAGCAGAGG No data
1124574304_1124574311 15 Left 1124574304 15:30894557-30894579 CCGTCCAAGCTCAGCATGAATTG No data
Right 1124574311 15:30894595-30894617 TCAGGCTAGCAGAGGCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124574304 Original CRISPR CAATTCATGCTGAGCTTGGA CGG (reversed) Intergenic
No off target data available for this crispr