ID: 1124575125

View in Genome Browser
Species Human (GRCh38)
Location 15:30901438-30901460
Sequence ATGGATGAACAGATAAAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124575125_1124575127 -8 Left 1124575125 15:30901438-30901460 CCATGCTTTATCTGTTCATCCAT No data
Right 1124575127 15:30901453-30901475 TCATCCATTGATGGCCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124575125 Original CRISPR ATGGATGAACAGATAAAGCA TGG (reversed) Intergenic
No off target data available for this crispr