ID: 1124582991

View in Genome Browser
Species Human (GRCh38)
Location 15:30978421-30978443
Sequence GGTTCTGTCCACCATGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124582988_1124582991 30 Left 1124582988 15:30978368-30978390 CCTGTGAAAAGAGTGCTGAATGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1124582991 15:30978421-30978443 GGTTCTGTCCACCATGAGTTGGG 0: 1
1: 0
2: 1
3: 9
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124582991 Original CRISPR GGTTCTGTCCACCATGAGTT GGG Intronic
900154517 1:1198608-1198630 GGTTCTGTTCCCCATGGGTCTGG + Intergenic
900608531 1:3534732-3534754 GGCTGTGTCCACCATGGCTTAGG - Intronic
903476605 1:23623661-23623683 GGCTCTGTCCTCCATGAACTTGG - Intronic
903514524 1:23901699-23901721 GGATCTGTCCGACATGAATTTGG + Intronic
903846095 1:26280616-26280638 GGTTCTGGCCTCTAGGAGTTGGG - Intronic
905237425 1:36559837-36559859 GGTTCTGTCTCCCATCAGCTGGG - Intergenic
906235097 1:44201882-44201904 TGTTCTGTACACTATGAGCTAGG - Intergenic
908766589 1:67559856-67559878 GGTTCTTTCCACCACAACTTTGG - Intergenic
915535688 1:156534036-156534058 GGTGATGTACACCATGGGTTTGG + Exonic
915823413 1:159050386-159050408 GGTTCTGTGCACCTTGTGTCAGG + Intronic
920874619 1:209822564-209822586 GATGCTGCCCACCATGACTTTGG - Intergenic
921200342 1:212799286-212799308 GGCTCTGGCCAAAATGAGTTTGG + Intronic
924951178 1:248885024-248885046 AGTTCTGGCCACTATGAGATGGG - Intergenic
1063360546 10:5452621-5452643 GGTTTTGTTCACCATGTATTAGG - Intronic
1073513905 10:104060480-104060502 GGGCCTGGCCACCAAGAGTTTGG + Intronic
1074760459 10:116663643-116663665 GGTTATGTTGACCATGAGCTAGG - Intergenic
1077741267 11:4848560-4848582 GGTTCTTTCAGCCATGGGTTTGG - Exonic
1079148174 11:17873361-17873383 GTTTCTGTGCACAATGAGATAGG - Intronic
1079555023 11:21749592-21749614 GTTTCTGTCCACGCTAAGTTAGG + Intergenic
1081237933 11:40668553-40668575 GGTTTTGTCCAGCAAGAGTCAGG - Intronic
1081307980 11:41536742-41536764 GGTTCTGCCCACCTTAATTTTGG - Intergenic
1083989944 11:66240708-66240730 GTTTCTGTCCAGCATGGGTTTGG + Intronic
1087217275 11:95507553-95507575 GTTTCTGTGCATCAGGAGTTTGG + Intergenic
1091191191 11:133696606-133696628 TGTTCTGTGCACCATGATTTTGG + Intergenic
1093975232 12:25414229-25414251 GGTTCTGTCCACCAGTACTGGGG - Intronic
1099434461 12:82627097-82627119 GAGGCTGTCCACCAGGAGTTAGG + Intergenic
1102933439 12:116879180-116879202 GGTTCTGTCGTCCAGGAGATTGG - Intronic
1107587534 13:41867629-41867651 GATTATATCCACCATGAGCTAGG - Intronic
1115472151 14:33779141-33779163 GTTTCTGTTCCCCAGGAGTTGGG - Intronic
1117751116 14:58924497-58924519 GGTTCTGGCCAACATCAGATTGG + Intergenic
1123806527 15:23879666-23879688 GGTTGTGTACACCAAGAGGTGGG + Intergenic
1124582991 15:30978421-30978443 GGTTCTGTCCACCATGAGTTGGG + Intronic
1126178913 15:45765816-45765838 GGATCTTTCCACCATTAGTTAGG + Intergenic
1127673976 15:61222927-61222949 GTTTCTGTCTACCATTAGATGGG + Intronic
1128364260 15:66986165-66986187 GGTGCTCTCCAGCATGACTTTGG + Intergenic
1131333578 15:91525538-91525560 GGTTCTATCCACCCTGTGTGGGG + Intergenic
1133108725 16:3532865-3532887 GGTTCTGTGCACTCTGGGTTTGG + Intronic
1133207447 16:4241927-4241949 TTTTCTGTCTACCATGGGTTGGG - Intronic
1138729028 16:59174464-59174486 GGTTCAGACACCCATGAGTTTGG - Intergenic
1142597764 17:1037821-1037843 GCTTCTGGCCACCATGAGCTCGG - Intronic
1142716989 17:1752663-1752685 GGTACTGGCCAACCTGAGTTGGG + Exonic
1143720793 17:8807685-8807707 GGCTCTTCCCACCATGTGTTGGG - Intronic
1148673689 17:49432373-49432395 GGTCCTGGCCTCCAGGAGTTTGG - Intronic
1151574720 17:74946998-74947020 TGTGCTGCCCACCATGAGTCTGG + Exonic
1151931917 17:77237851-77237873 GGTCCTGCCCACCGAGAGTTAGG + Intergenic
1156323774 18:36054025-36054047 GTTTATGTGCACAATGAGTTTGG + Intronic
1157238321 18:45984888-45984910 GGTTCTGTCCCTCATCAGCTAGG + Exonic
1158623597 18:59052738-59052760 TGTTCTTTCCACCTAGAGTTGGG + Intergenic
1161205273 19:3037597-3037619 GGTTCTGACCAGCAGGAGTCAGG + Intronic
925219407 2:2126000-2126022 TGTTGTGTCCACCATGATCTGGG - Intronic
926181303 2:10646124-10646146 GTTTCTGTCCATCATGACCTCGG - Intronic
926672813 2:15591682-15591704 CGTTCTGGGCACCATGTGTTCGG - Exonic
926802117 2:16667516-16667538 TAATCTGTCCACCTTGAGTTTGG + Intergenic
929413828 2:41727209-41727231 GGCTCTGTTTACCATGATTTGGG - Intergenic
929605771 2:43233109-43233131 GCTTCTGTCCACACTGAGTTAGG - Intronic
935173480 2:100628616-100628638 GGTTCTGTCCACCCTCAGAGTGG + Intergenic
936626930 2:114158276-114158298 GGTTCTGTACACCAGGAGGCAGG - Intergenic
939840001 2:147175269-147175291 GTTTCTGTTCAGCTTGAGTTTGG + Intergenic
941153870 2:161950729-161950751 ATTACTGTCCACCATGGGTTTGG - Exonic
946590643 2:221243553-221243575 AGTTTTGTCCACAATGATTTGGG - Intergenic
947016757 2:225629623-225629645 GCTTCTGCTCACCATGAGGTTGG + Intronic
948286813 2:236792556-236792578 GGTTCTGAACCCCATGTGTTGGG - Intergenic
948335754 2:237205795-237205817 GGTTCTGTTCACAATGAATTAGG - Intergenic
948359770 2:237412041-237412063 GCTTCTCTCGACCATGAGTGAGG + Intronic
1171033187 20:21694873-21694895 GCCTCTGTTCACCATGAGGTTGG - Intergenic
1178581056 21:33839107-33839129 GGGGATGTCTACCATGAGTTGGG + Intronic
1181761629 22:25062704-25062726 GGTTCTCTCCACCATGCGGAGGG - Intronic
1184103983 22:42356917-42356939 GTTTCTGTCCTGCATGAGTGTGG - Intergenic
1185013510 22:48330385-48330407 GGCTCTGTCCACCACCAGCTTGG + Intergenic
952525748 3:34208830-34208852 GGTTCTTTCTTCCAAGAGTTTGG - Intergenic
954914742 3:54139174-54139196 GGTGCGTTCCACCATGAGATGGG + Intronic
957687638 3:83523287-83523309 AGTTCTATCCACCTTAAGTTTGG - Intergenic
963586169 3:147192062-147192084 GGTTCTGTCCCACCTGACTTGGG - Intergenic
964309293 3:155375530-155375552 GGTGCTCTTCACCCTGAGTTTGG - Intergenic
970530935 4:16982719-16982741 GTTTCTGTGCATCAGGAGTTTGG - Intergenic
972179784 4:36449401-36449423 AGCTCTGTCCACCCTGACTTGGG + Intergenic
983226487 4:165090450-165090472 GCTTCTGTCCACGTGGAGTTGGG - Intronic
984610619 4:181832930-181832952 GATTGTGTCCACCACTAGTTTGG - Intergenic
989710740 5:44393922-44393944 GGTTCTGTTTACCATCAGCTGGG - Intergenic
992744502 5:79805996-79806018 AGTTGTGTTCACCATGGGTTGGG + Intergenic
994309238 5:98248102-98248124 GGTTCTGTCCAGCATGAGGTTGG - Intergenic
997773250 5:136574003-136574025 GCTTCTGTCAACTTTGAGTTCGG + Intergenic
999849999 5:155527745-155527767 GGTTCTGTCAGCCAACAGTTTGG + Intergenic
1002701310 5:181127174-181127196 GTTTCTGTTCACCATGACGTTGG + Intergenic
1003052327 6:2791353-2791375 GTTTCTGTCCACCAGGAGTCAGG + Intergenic
1003877694 6:10452733-10452755 GGTTCTTTCCTCCAGGATTTTGG + Intergenic
1005811136 6:29517425-29517447 GCTTCTGTCCACCAGGTGTCAGG - Intergenic
1006155296 6:32010219-32010241 GGTTCTGTCCACCAGGGGTGTGG + Intergenic
1006161602 6:32042953-32042975 GGTTCTGTCCACCAGGGGTGTGG + Exonic
1012606926 6:101168831-101168853 GGTTTTGTGGACCAGGAGTTTGG - Intergenic
1019480113 7:1262530-1262552 CGTCCTGCCCACCATGAGCTGGG + Intergenic
1023868193 7:44248858-44248880 GGGGCTGTCTCCCATGAGTTTGG - Intronic
1033897383 7:146090669-146090691 GTTCCTGTCTTCCATGAGTTGGG + Intergenic
1034659435 7:152756765-152756787 GTTTTTGTCCATCATGATTTTGG + Intergenic
1043777109 8:84283653-84283675 GGTTCTGGCCACATTTAGTTGGG + Intronic
1046873288 8:119227015-119227037 GGTACAGTCCACCAGGGGTTGGG + Intronic
1047492833 8:125388605-125388627 TGTTCTGTCCACTATTCGTTTGG - Intergenic
1056270004 9:84938256-84938278 GTTTTTCTCCACCAAGAGTTTGG + Intronic
1056905687 9:90645754-90645776 GGTTGTGTCCACCAAGAGAGGGG - Intergenic
1187946565 X:24431883-24431905 GGATCTGTCCATCATGAATGAGG - Intergenic
1201612401 Y:15858001-15858023 AGTTCTGTCCCCGAGGAGTTGGG + Intergenic