ID: 1124583570

View in Genome Browser
Species Human (GRCh38)
Location 15:30984798-30984820
Sequence CAGCCTCAGCACAGGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 602
Summary {0: 1, 1: 0, 2: 6, 3: 59, 4: 536}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124583570 Original CRISPR CAGCCTCAGCACAGGGGCCC AGG Intronic
900088891 1:910639-910661 CAGCCTCCCCACTGAGGCCCAGG + Intergenic
900091143 1:921222-921244 CAGCCTCAGCCCAGCGGCGGAGG + Intergenic
900410504 1:2510482-2510504 CAGCCTGAGCCCAGGGGGCTCGG + Intronic
900417090 1:2540265-2540287 CAGCCTCACCCCAGCAGCCCTGG - Intergenic
900436066 1:2631906-2631928 GATCCCCACCACAGGGGCCCAGG + Intronic
900463082 1:2810625-2810647 CAGGCCCTGCACAGGGGCACAGG - Intergenic
900605632 1:3522421-3522443 CAGGCCCTGCCCAGGGGCCCTGG + Intronic
900641910 1:3691598-3691620 CAGCCTGAGCCCTGGGGACCTGG + Intronic
900759772 1:4462988-4463010 CAGCCTGTGGGCAGGGGCCCAGG - Intergenic
900951855 1:5862568-5862590 CACCCTCCGCTCAGGGGCACAGG + Intergenic
901026409 1:6280844-6280866 CAGCCCCACCCCACGGGCCCTGG + Intronic
901758568 1:11456096-11456118 CACCCCCAGCAGAGAGGCCCTGG - Intergenic
901855050 1:12039182-12039204 CAGCCTCAGCACTGGCCCCAGGG - Intergenic
902363918 1:15958619-15958641 CAGCCTTATCCCAGGGCCCCTGG - Intronic
902526970 1:17065476-17065498 CAGGCTTAACCCAGGGGCCCAGG - Intergenic
902527747 1:17070295-17070317 CAGCACCAGGCCAGGGGCCCCGG + Intronic
902678851 1:18029104-18029126 CTGCCCCAGCACTGGGGCCTGGG - Intergenic
902728361 1:18352136-18352158 AGGCCTCAGCAGAGGGGCACAGG - Intronic
902933565 1:19747891-19747913 CAGCCGCAGCAAAGGGGCTCAGG - Intronic
903181110 1:21605300-21605322 CAGCCACACCACAGAGGCCCTGG + Intronic
903370999 1:22836127-22836149 CAGCCTCTCCAGAGGGGCCCCGG + Intronic
903759028 1:25684888-25684910 CAGCAGCAGCACAGGGGAACTGG + Intronic
904606754 1:31702161-31702183 CAGCCACAGGCCAGGAGCCCAGG + Exonic
905006219 1:34712407-34712429 CTGACACAGCACAGGGGCCTTGG + Intergenic
905337717 1:37256955-37256977 AAGACTCGGCACAAGGGCCCTGG - Intergenic
905694507 1:39965043-39965065 CAGCCTCTTCCCAGAGGCCCAGG + Intronic
907311889 1:53543517-53543539 CAACATAAGCACAGGGGCCAGGG - Intronic
907381835 1:54097051-54097073 TAGCCTCAGCATGGGGGCTCTGG - Exonic
908084780 1:60619761-60619783 CAGCTTCAGCCTAGGGGCCTAGG - Intergenic
909501336 1:76338482-76338504 CAGCCCCAGTGCAGGGGGCCAGG - Intronic
912879124 1:113390950-113390972 CCGTCTCAGCCCGGGGGCCCTGG - Exonic
912978258 1:114348776-114348798 CAGCCTGAGCACAGGAATCCTGG + Intergenic
914920066 1:151840306-151840328 CAGCTTCAGCAGAGGAGGCCTGG - Exonic
915143900 1:153783478-153783500 CAGCCGCAGCCCAGCGGCGCAGG - Intergenic
915217604 1:154350476-154350498 CAGCCCCACCACAGGGCCCTGGG - Exonic
915268616 1:154735811-154735833 CTGCCTCAGCACAGGGCCTGAGG - Intronic
915270618 1:154750832-154750854 GAGCATCAGCTCAGAGGCCCAGG + Intronic
915837910 1:159192633-159192655 CAGCATCAGCAATGTGGCCCTGG + Exonic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
915949804 1:160181583-160181605 CTGACTCAGCCCAGGGGTCCTGG + Intronic
916081095 1:161232884-161232906 CAGAGGCAGCACAGGGGCCAGGG + Exonic
917279971 1:173370954-173370976 CTGCCTCAGCATAGGGGACGTGG - Intergenic
917281257 1:173379858-173379880 CTGCCTCAGCATAGGGGACATGG - Intergenic
917769145 1:178257758-178257780 CAGCCTCAACTCACGGGCTCAGG - Intronic
919777806 1:201205595-201205617 CAGCCTTGGGACAGTGGCCCAGG + Intronic
919859779 1:201731889-201731911 GAGCCTCCACAGAGGGGCCCTGG + Intronic
920380149 1:205530446-205530468 CAGCCCCAGCAGAGCAGCCCCGG + Intronic
921117890 1:212111775-212111797 TAGCGTCAGCTCAGGAGCCCAGG + Intergenic
921530637 1:216278204-216278226 CAAGCTCATCACAAGGGCCCAGG - Intronic
922754960 1:228090601-228090623 CAGCCACTGCACTGGGGGCCAGG + Intronic
923137940 1:231134652-231134674 CAGCCTCAGCCAAGCAGCCCAGG - Intergenic
923556823 1:235007625-235007647 CTGCCTCAGCACAGTCCCCCTGG - Intergenic
924034492 1:239922545-239922567 CACACTCAACACAGTGGCCCTGG - Intergenic
1064033350 10:11896949-11896971 AAGGGTCAGCACAGGGTCCCTGG + Intergenic
1066694313 10:38064361-38064383 AAGCCTCAGCCCTGGGCCCCAGG - Intronic
1066998206 10:42582815-42582837 AAGCCTCAGCCCTGGGCCCCAGG + Intronic
1067474016 10:46554829-46554851 CTGCCACAGCAGAGGAGCCCAGG + Intronic
1067556735 10:47278114-47278136 CAGCCACAGAACAGGGGTCCAGG - Intergenic
1067842842 10:49695519-49695541 CTCCTTCAGCACAGGTGCCCCGG - Intronic
1067848876 10:49742788-49742810 CAGCATCCGCACAGGAGACCTGG - Intronic
1069855729 10:71439933-71439955 CAGCCTCTGCACGGGAGGCCAGG + Intronic
1069861183 10:71472671-71472693 CAACCCCAGCACAAGGGCTCAGG - Intronic
1069957972 10:72063183-72063205 CAGGGTCAGAGCAGGGGCCCAGG + Intronic
1070882727 10:79863698-79863720 CAGCCTGAGCTCACAGGCCCTGG - Intergenic
1071516010 10:86298487-86298509 CACCCCCAGCACAGGGGTTCTGG - Intronic
1073717323 10:106121947-106121969 CAGCGACAGCACAGGTGGCCGGG - Intergenic
1074107623 10:110400292-110400314 CATCCTCTGGACAGGTGCCCAGG + Intergenic
1075475063 10:122727427-122727449 CAGCTGCAGCAGAGGGGGCCTGG - Intergenic
1075726748 10:124614462-124614484 CGGCCTTCCCACAGGGGCCCTGG + Intronic
1075810725 10:125222793-125222815 CAGCCTCTGCTCAGGGTCTCAGG - Intergenic
1075830831 10:125409370-125409392 CACACTCAGCTCAGTGGCCCAGG - Intergenic
1075840066 10:125493981-125494003 AAGGCCCAGCACAGGGGCCTGGG + Intergenic
1076151384 10:128164313-128164335 CATCCACAGCTCAGGGGGCCAGG + Intergenic
1076178584 10:128387741-128387763 CAGCCTCAGCACCAAAGCCCAGG + Intergenic
1076214872 10:128685502-128685524 CTGCATCAGCACAGAGTCCCTGG + Intergenic
1076571895 10:131438643-131438665 CAGCCTCTGTCCAGGGGCACTGG - Intergenic
1076579394 10:131496531-131496553 CAGGCTCTGCACATGGACCCAGG + Intergenic
1076597868 10:131637121-131637143 GAGCCTCACCACAGGGGCATCGG - Intergenic
1076728907 10:132428712-132428734 GAGCCTCAGCAGTGTGGCCCTGG + Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076792467 10:132784680-132784702 CAGCCTCCGCACCGGGAACCCGG + Intergenic
1076816484 10:132917494-132917516 CGGCCCCATCACAGGGACCCTGG + Intronic
1076850197 10:133088747-133088769 CACCCTGAGGCCAGGGGCCCGGG + Exonic
1076885271 10:133259201-133259223 GAACCTCAAGACAGGGGCCCGGG + Intergenic
1077093774 11:790883-790905 CAGCCTCTGCATAAGGCCCCTGG - Exonic
1077326723 11:1967160-1967182 CAGCAGCAGCACAGAGCCCCGGG - Intronic
1077911114 11:6571776-6571798 CAGCATCAGCACACAGGCCCCGG + Exonic
1078104358 11:8349465-8349487 CAGAATCATCACAGGGGCTCTGG + Intergenic
1078934909 11:15941706-15941728 GGGCCTCAGCACAGGGAGCCTGG + Intergenic
1081634437 11:44711489-44711511 TTCCCACAGCACAGGGGCCCTGG + Intergenic
1081650344 11:44819371-44819393 CAGGCTAATCGCAGGGGCCCAGG + Intronic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1081773248 11:45662476-45662498 CAGCCTCTCCCCAGCGGCCCCGG - Intronic
1082080804 11:48011086-48011108 CTGCCTTTGCCCAGGGGCCCTGG - Intronic
1083108179 11:60378630-60378652 CAGCCACAGCACACAGGACCAGG + Exonic
1083339875 11:61952093-61952115 CAGCCTCAGCTCCAGTGCCCAGG - Intronic
1083367284 11:62148853-62148875 GAGCCTCTCCACTGGGGCCCAGG - Intronic
1083700872 11:64476985-64477007 CAGCCTCAGCAGAGGGGGGTAGG - Intergenic
1083789012 11:64971940-64971962 CGGCCTCAGAAAAGTGGCCCCGG + Intronic
1084149461 11:67281407-67281429 CACCCTCAGAGCAGGGGCCCAGG - Intronic
1084214500 11:67640071-67640093 CAGCCTCAGGTCAGGGGTCTGGG - Intergenic
1084296521 11:68216008-68216030 CAGCCTCAGCTGAGAGGCCCAGG + Intergenic
1084323089 11:68384403-68384425 ATGCCCCTGCACAGGGGCCCAGG - Intronic
1084415722 11:69031982-69032004 CAGTCTCAAGACAGGGGCCCAGG - Intergenic
1084490939 11:69477945-69477967 CATCCCCACCACAGGGGCCACGG - Intergenic
1084858817 11:72005143-72005165 TAGCCTGAGCACTAGGGCCCTGG - Intronic
1085393744 11:76195667-76195689 GAGCCTCAGCTGCGGGGCCCTGG + Intronic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1087496317 11:98894416-98894438 CACACACAGCACAGGGACCCTGG + Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088881669 11:113977792-113977814 CAGCCTCAGCAGAGCGGGCCTGG - Exonic
1090425398 11:126603725-126603747 CAGCCCCAGCACACCTGCCCAGG - Intronic
1090650546 11:128802332-128802354 CAGCCTGAGCACATTGGCTCTGG - Intronic
1091277107 11:134360092-134360114 CAGGCTGTGCTCAGGGGCCCAGG + Intronic
1091294862 11:134466548-134466570 CAGCCTCAGCACGGGGCTGCAGG + Intergenic
1202809704 11_KI270721v1_random:22340-22362 CAGCAGCAGCACAGAGCCCCGGG - Intergenic
1091727954 12:2858608-2858630 CAGCTTGAGCACAGGGGCAAGGG + Exonic
1091798316 12:3309643-3309665 CAGCATCTGCACAGGTGTCCTGG - Intergenic
1091834686 12:3577203-3577225 GGGCCCCAGCACAGGGGCCCTGG + Intronic
1092162874 12:6325636-6325658 CAGCTTCAGGGCAGAGGCCCAGG + Intronic
1094493663 12:30976583-30976605 GGGCCTCAGGACAGGGGCCTGGG - Intronic
1094496890 12:30994300-30994322 CAGCCTCCAAACAGGGGCCCGGG - Exonic
1094828997 12:34291298-34291320 CAGCCCCTGCACAGGGTCCCAGG - Intergenic
1094829705 12:34294486-34294508 CAGCCCCAGCACAGTGCCCAGGG - Intergenic
1094834893 12:34317712-34317734 CAGCCCCTGCACGGGGCCCCAGG - Intergenic
1094836510 12:34324631-34324653 CAGCCACTGCGCAGGGCCCCGGG - Intergenic
1096469090 12:51865059-51865081 CAGCATCAGGCCAGGGGCCCAGG - Intergenic
1096648399 12:53050193-53050215 CAGCCTCTCCACAGGGCCGCTGG - Intronic
1097036790 12:56129437-56129459 CCGCCTCAGCACAGGAGACGCGG - Intronic
1097522775 12:60689392-60689414 GAGCCCCAGCAGAGGGACCCTGG + Intergenic
1098888755 12:75986526-75986548 CAGTCTCAGTACAGCAGCCCTGG + Intergenic
1099237569 12:80099935-80099957 CAGCCACAGAACACGGGACCAGG - Intergenic
1100690904 12:97037646-97037668 CAGCATCAGCACAAGGCCCATGG - Intergenic
1101997555 12:109535747-109535769 CTTCCTCAGCACAGGGAACCCGG + Exonic
1102842550 12:116141643-116141665 CACCCTCACCACAGGGACTCTGG + Intronic
1103474810 12:121210434-121210456 CAGCCGCCGCGCCGGGGCCCCGG + Intronic
1103727362 12:123004781-123004803 CAGACTCAGGTCAGAGGCCCAGG - Intronic
1103839979 12:123855119-123855141 CAGACTCAACACAGGAGCCCCGG - Intronic
1104642800 12:130478127-130478149 CAGACCCATCACAGGTGCCCAGG + Intronic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1105701131 13:22936353-22936375 CAGGCTCAGCAGAGCTGCCCTGG + Intergenic
1105853962 13:24359401-24359423 CAGGCTCAGCAGAGCTGCCCTGG + Intergenic
1106036087 13:26046812-26046834 CAGCGCCAACTCAGGGGCCCGGG - Exonic
1106394018 13:29362914-29362936 CAGCCTCAGCCCAGCGTCCAGGG + Intronic
1106411451 13:29514243-29514265 CAGCCGCAGCCTAGTGGCCCCGG + Exonic
1106484516 13:30160471-30160493 CAGCCCCAGCTCTGGGGCCCAGG + Intergenic
1107062158 13:36171412-36171434 CAGGCTCAGCACAGAAACCCTGG + Intronic
1110466545 13:75808107-75808129 CAGCCTCACTGCAGGGGCCAGGG - Exonic
1112754192 13:102612218-102612240 CAGCCTCATCACACAGGCCAGGG - Intronic
1113335508 13:109372702-109372724 CAGCCTCAGCACCGTTTCCCGGG + Intergenic
1113615985 13:111681050-111681072 CAGCCCCTGCCCAGTGGCCCCGG + Intergenic
1113621453 13:111765943-111765965 CAGCCCCTGCCCAGTGGCCCCGG + Intergenic
1113833136 13:113312635-113312657 AATCCTCAACACAGGGCCCCGGG + Intronic
1113849030 13:113407572-113407594 CAGCCTCAGCGCACTGGCCTCGG + Intergenic
1113917092 13:113880924-113880946 GAGCCTCAACACGGGGGCCCTGG + Intergenic
1114655328 14:24312163-24312185 CCTCCTCAGCCCAGGTGCCCTGG + Intronic
1115041252 14:28931783-28931805 CAGCATAATCACAGGGGCCCTGG - Intergenic
1116644578 14:47510152-47510174 CATCCTCATAAAAGGGGCCCCGG + Intronic
1117513261 14:56473715-56473737 CGGCCTCAGCACAGGGAGTCAGG - Intergenic
1121644610 14:95509267-95509289 CAGCTTGAGCACAGGTGTCCAGG + Intergenic
1121702973 14:95970250-95970272 GAGCCTCAGCAGTGGGGCCAGGG - Intergenic
1121776174 14:96592639-96592661 CAGTCACCGCACAGGTGCCCTGG + Intergenic
1121838318 14:97111960-97111982 CATCATCAGGACAGAGGCCCTGG - Intergenic
1121963107 14:98279262-98279284 CAGCTTCAGCATGGGGGCCTTGG - Intergenic
1122205153 14:100144666-100144688 CTGCCTCAGGGCAGGGGCCTGGG - Exonic
1122274761 14:100585896-100585918 CGGGCTCAGCACACGGGCTCTGG - Intronic
1122768355 14:104086101-104086123 CAGCGGCAGCACAGGGGGCCTGG - Intronic
1122812088 14:104294062-104294084 CAGCCTCAGGACAGGGAGCACGG - Intergenic
1123039879 14:105486171-105486193 CAGCCTCAGGAAGGGAGCCCAGG - Intergenic
1202898313 14_GL000194v1_random:22398-22420 CAGCCCCTGCACTGGGCCCCGGG - Intergenic
1202898473 14_GL000194v1_random:23033-23055 CAGCCCCTGCACTGGGCCCCAGG - Intergenic
1124120158 15:26882264-26882286 CAGCCCCAGCAGGGTGGCCCGGG - Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124685369 15:31777647-31777669 CACCCTCAGCCCAGGCCCCCAGG + Intronic
1126142683 15:45450798-45450820 CAGCCTCAGCGAGGCGGCCCTGG + Intergenic
1126585229 15:50279731-50279753 CAACCTCATCACAGATGCCCAGG + Intronic
1128390379 15:67178803-67178825 CAGCCTCACCTCAGGGGCCAGGG + Intronic
1129753854 15:78084201-78084223 CAGCCCCAGCAAGGGAGCCCAGG + Intronic
1130096074 15:80857201-80857223 GAGCCTGAGAACAGGAGCCCGGG + Intronic
1131619493 15:94052676-94052698 CAGCCTCACCTCAGGGGACAGGG - Intergenic
1132314681 15:100880820-100880842 CAGCCCCAGCTCAGAGGCCTCGG - Intronic
1132331090 15:101012968-101012990 CAGACTCAGAACAGGGGCCCAGG - Intronic
1132333533 15:101028782-101028804 CAGCCTGATCACAGGTGCCCTGG - Intronic
1132694079 16:1194419-1194441 CAGCCCTGGGACAGGGGCCCTGG + Intronic
1132700368 16:1219712-1219734 CAGCCTCAGCTCTGTGCCCCTGG + Intronic
1132785190 16:1653114-1653136 AAGGCTCTGCACACGGGCCCAGG - Exonic
1132881409 16:2163213-2163235 CAGCCACGCCACAGGGGCTCAGG - Intronic
1133083856 16:3346113-3346135 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1133384747 16:5360312-5360334 CTCCCTCAGCAGAAGGGCCCTGG - Intergenic
1134827162 16:17294080-17294102 CATTCTCAGCACAGTCGCCCAGG - Intronic
1135256236 16:20943638-20943660 AAGCCTCAGCTCAGGGGCTTTGG + Intronic
1136269328 16:29139243-29139265 CAGGCTCAGCAAGGGGGCACTGG - Intergenic
1136272519 16:29156857-29156879 CTTCCTTAGCAGAGGGGCCCTGG + Intergenic
1136428810 16:30185556-30185578 CAGCCACAGCACAGAGGAGCTGG - Intronic
1136569062 16:31086154-31086176 GAGGCACAGCACAGGGCCCCCGG + Exonic
1138002757 16:53299034-53299056 CAGCCTCAGCACCTGGAACCAGG + Intronic
1138205076 16:55118756-55118778 CAGCCTCCCCAGAGAGGCCCTGG + Intergenic
1138550148 16:57743395-57743417 CAGCCTCAGCAAGGGTGCCAGGG + Intronic
1138600286 16:58049947-58049969 CAGCCTGAGGACAGGTGCCTGGG + Intergenic
1139968235 16:70757446-70757468 CAGCCTCAGCCCAGGAGTGCTGG + Intronic
1139971920 16:70781683-70781705 CAGCATCAGCCCCGGGTCCCTGG + Intronic
1140891657 16:79290136-79290158 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1141395205 16:83698472-83698494 GAGCCTCAGCACTGGGAACCAGG - Intronic
1141574920 16:84957720-84957742 CATTCTCAGCACTGAGGCCCCGG - Intergenic
1142130819 16:88430777-88430799 CAGCCTCCGCCGCGGGGCCCCGG + Exonic
1142134501 16:88445441-88445463 AAGCCTCGCCGCAGGGGCCCAGG - Intergenic
1142242047 16:88952010-88952032 CCACCTCTGCACAGGGGTCCTGG - Intronic
1142251496 16:88993921-88993943 CAGCCTCCTCACTGGGCCCCTGG - Intergenic
1142289992 16:89189524-89189546 CAGCCTGAGGACTGGGTCCCAGG + Intronic
1142292638 16:89200010-89200032 CAGCCCCTGCACAGGGGTCGGGG + Intronic
1142344040 16:89542663-89542685 GAGGCTCAGGACAGTGGCCCTGG + Intronic
1143527669 17:7481933-7481955 CAGCCGCAGCCCAGGCGACCTGG - Intronic
1143612283 17:8025681-8025703 CAGCCCCAGAGCAGGGGCCAGGG + Intergenic
1143633092 17:8149914-8149936 CTGCCTCAACACGGGAGCCCAGG + Intronic
1144697287 17:17313618-17313640 CAGCCTCATCCCAGGGGCTGCGG + Intronic
1144965755 17:19076502-19076524 CAGGCTCAGGTCCGGGGCCCTGG - Intergenic
1144982212 17:19175680-19175702 CAGGCTCAGGTCCGGGGCCCTGG + Intergenic
1144986011 17:19202559-19202581 CAGGCTCAGGTCCGGGGCCCTGG - Intergenic
1145021463 17:19434868-19434890 CAGCCTTTGTATAGGGGCCCTGG - Intergenic
1145208004 17:20994882-20994904 CAGCCTCAGCCCAGGGGAGGAGG - Intergenic
1146617350 17:34367555-34367577 CAGCATCAGCACATGAACCCAGG + Intergenic
1146885232 17:36465786-36465808 CAGTCTCAGTGCAGGGGACCGGG + Intergenic
1146917339 17:36686670-36686692 CAGCCTAATCACAGCAGCCCTGG + Intergenic
1147026154 17:37586072-37586094 CAGCCTCAACCTCGGGGCCCAGG + Intronic
1147555553 17:41476811-41476833 CAGCCTGAGAACAGAGACCCTGG + Exonic
1147627730 17:41910673-41910695 CAGCCTCAGGACATGGGTCCGGG + Intronic
1148220457 17:45858186-45858208 AGGGCCCAGCACAGGGGCCCTGG - Intergenic
1148243630 17:46016035-46016057 CAGCTACAGCACAGGAACCCTGG + Intronic
1148343006 17:46884521-46884543 CAGCCTGATGACAGAGGCCCAGG + Intronic
1148624165 17:49056191-49056213 CAGCCTCAGCATGGGAGCCCTGG + Intergenic
1148992969 17:51682352-51682374 CAGCCTCCTCACAGTGGCCAGGG - Intronic
1149866025 17:60151375-60151397 CAGCCTCTCCACCGGGCCCCTGG + Intronic
1151659374 17:75510529-75510551 CAGACTCATCACAGAGGGCCTGG - Intronic
1151964964 17:77426371-77426393 CAGCGTGAGCCCAGGAGCCCCGG + Intronic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1152534283 17:80941412-80941434 CAGCCCCATCCCAGGGACCCTGG + Intronic
1152593996 17:81229410-81229432 CAGGCTCAGCTGAGGTGCCCCGG + Exonic
1152743887 17:82030535-82030557 CGGCCTCAGCACGGGAGACCTGG - Intronic
1153378212 18:4405966-4405988 CAGGCTCAGCTCAAGAGCCCTGG + Intronic
1153739214 18:8105676-8105698 CGCCCTCAGCACTGGGGGCCTGG - Intronic
1155536878 18:26827959-26827981 CAGCATCCACACAGGAGCCCAGG - Intergenic
1157184060 18:45523205-45523227 CAGACTCAGCATAGGGGCTGGGG - Intronic
1157713703 18:49867474-49867496 CAGCCTCAGCACACTCTCCCGGG - Intronic
1158597424 18:58828299-58828321 CCGGCTCAGCATAGGGGCTCAGG - Intergenic
1160277532 18:77451605-77451627 CAGCCCCTGAACAGGGGCACGGG - Intergenic
1160330454 18:77986937-77986959 CGGCCCCGGCACAGGGGCACTGG - Intergenic
1160397389 18:78582584-78582606 CACCCTCAGCAAAGCGGCCGGGG + Intergenic
1160495226 18:79369619-79369641 CAGACTCAGGACAGGAGTCCTGG + Intronic
1160511374 18:79455426-79455448 CTGCCTCCCCAGAGGGGCCCCGG - Intronic
1160692892 19:467902-467924 CAGCCACAACTCAGGGCCCCTGG - Intronic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160908916 19:1465917-1465939 CAGCCTCAGCTCTGGAGACCCGG + Exonic
1161005670 19:1935070-1935092 CTGCCTCTTCACAGGGGCACGGG - Intergenic
1161015666 19:1981631-1981653 AAGCCTCAGCGACGGGGCCCAGG + Intergenic
1161570777 19:5029891-5029913 CACTCTCAGCACAGGGACTCAGG - Intronic
1161579333 19:5072094-5072116 CAGCCTCAGTACAGGCTCCCGGG + Intronic
1162033042 19:7925579-7925601 CAGCCTCATCCCCGGCGCCCGGG - Intronic
1162043271 19:7983207-7983229 GAGACTCAGCTCTGGGGCCCTGG + Intronic
1162456922 19:10790845-10790867 CAGCCTCACCACTTGGGCTCAGG + Intronic
1162502244 19:11060475-11060497 CGGCCTCAGCCCAGGAGCCCTGG - Intronic
1162722493 19:12670621-12670643 GGGCCTAAGCACGGGGGCCCAGG + Exonic
1163263219 19:16203830-16203852 CCTCTTCAGCCCAGGGGCCCAGG + Intronic
1163263582 19:16205486-16205508 CCAGCACAGCACAGGGGCCCAGG - Intronic
1163613996 19:18315959-18315981 CAGCCTCAGCACAGGGGCGGTGG - Intronic
1164746592 19:30620580-30620602 TAGACTCTGCACAGTGGCCCAGG - Intronic
1164996168 19:32721060-32721082 CAGCCCCAGCCCATGGGTCCGGG + Intronic
1165899693 19:39163322-39163344 CACCCAGAACACAGGGGCCCAGG - Intronic
1166539337 19:43595126-43595148 CACCCGCAGCGCCGGGGCCCTGG - Exonic
1166737231 19:45093295-45093317 CCGCCTCCTCACGGGGGCCCCGG - Exonic
1166965472 19:46527177-46527199 CACCATCAGCACTGGTGCCCGGG - Intronic
1167506377 19:49873154-49873176 CAGCATAGGCACAGGGGCCCGGG + Exonic
1167765455 19:51479449-51479471 CAGCCTGTGCTCAGGGGCGCTGG + Intronic
1168094996 19:54109416-54109438 CAGGCTCGGCACAGTGGCCCAGG - Intronic
1202647934 1_KI270706v1_random:158308-158330 CAGCCCCTGCACTGGGCCCCGGG + Intergenic
925055227 2:852084-852106 CGGCCTCTGCCCAGGGCCCCAGG - Intergenic
925444392 2:3915354-3915376 GAGCCCAAGCACAGTGGCCCAGG + Intergenic
925557895 2:5152535-5152557 CAGCATGACCACAGAGGCCCAGG - Intergenic
925826808 2:7857490-7857512 CAGGCTGTGCACAGGGGTCCAGG + Intergenic
925915259 2:8600160-8600182 CACCCTCTGAACAGAGGCCCAGG + Intergenic
926740001 2:16102951-16102973 GAGCCTGAGCCCAGGGGCCGAGG + Intergenic
926937975 2:18105041-18105063 CAGGCTATGCACAGGGGCCCAGG - Intronic
927206827 2:20616380-20616402 CAGCTTCAGCCCTGGGACCCAGG - Intronic
927569335 2:24144679-24144701 TGACCTCAGCACAGGGGCCACGG + Intronic
927696439 2:25242634-25242656 CAGTCTCAACCCAGGGACCCTGG - Intronic
927714452 2:25342598-25342620 CTGCCTCAGCACTGGGGCTGGGG + Intergenic
928106592 2:28474332-28474354 GAGCCTCAGCTCAGTGTCCCTGG - Intronic
928130298 2:28644249-28644271 CAGCCTGAGCCCAGTGTCCCAGG + Intergenic
928149090 2:28810524-28810546 CAGCCCCAGCCCCGGGGGCCTGG + Intronic
928199873 2:29241010-29241032 CAGCCTCTGCAGAAGGGCCGTGG - Intronic
928480062 2:31674708-31674730 CAGCCTCAACAGAGGGGCCAGGG + Intergenic
929821114 2:45274487-45274509 CAGCCTCAGCAGAGAGCCTCCGG - Intergenic
930891919 2:56400228-56400250 CTGCCACAGCCCAGGGGCTCAGG - Intergenic
931700423 2:64904579-64904601 CAACAACAGCACAGTGGCCCCGG - Intergenic
932221900 2:70006178-70006200 CAGCCCCAGCACAGGACACCTGG - Intergenic
932575123 2:72958605-72958627 CAGCCTGAGCCCAGGGTCCTAGG - Intronic
932588052 2:73044560-73044582 GAGGCTCAGCAGAAGGGCCCGGG + Intronic
932615055 2:73226483-73226505 CAGCCTCAGGGAAGGGGCTCAGG - Exonic
932790967 2:74654317-74654339 CGGCCTCTGCTCAGGGCCCCGGG - Exonic
933386954 2:81622872-81622894 CAGCCTGGGCACAGAGGCTCCGG + Intergenic
933737110 2:85504095-85504117 CAGGCCCAGCACAGGTGTCCAGG + Intergenic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
934520144 2:95014979-95015001 CAGCGTCAGCACTGAGGCCAGGG - Intergenic
934765015 2:96875760-96875782 CAGTTACAGCACTGGGGCCCAGG - Intergenic
934980757 2:98837807-98837829 CAGGATCAGGATAGGGGCCCTGG - Intronic
937228600 2:120383973-120383995 CAGACACAACAGAGGGGCCCAGG + Intergenic
937265278 2:120611408-120611430 CAGCTTCAGCACAGCTTCCCAGG - Intergenic
937398669 2:121562221-121562243 CAGCCACAGCACAGGAACCTGGG + Intronic
937854959 2:126665683-126665705 CAGACTCGGCACAGGTGCCTGGG + Intronic
937863334 2:126730330-126730352 CAGCTCCAGCGCAGGTGCCCTGG + Intergenic
938489607 2:131754805-131754827 CAGCCCCTGCACTGGGACCCGGG + Intronic
939200831 2:139031731-139031753 CAGCTTCAGCTCAGGGCCCAAGG + Intergenic
940403099 2:153268894-153268916 CAGCCTCAGGACTGGTGCCTTGG - Intergenic
941866818 2:170344029-170344051 CAGCCTGAGGGCAGGAGCCCAGG - Intronic
941924931 2:170885261-170885283 CAGCCTCACCACTTGGGCTCAGG - Intergenic
942247750 2:174023602-174023624 CAGTTTCAGCAGAGCGGCCCTGG + Intergenic
944599390 2:201288027-201288049 CAGCCTCAGTAGAGGGGCTTGGG - Intergenic
946277589 2:218643012-218643034 CAGCCCCAGCCCGTGGGCCCCGG - Exonic
947249817 2:228089732-228089754 CAGCCACATCAAAGGGCCCCAGG + Intronic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
948234918 2:236380205-236380227 CGGCCTCAGCAGAGGCGCTCGGG + Intronic
948813942 2:240500138-240500160 CAGGGTCACCACAGGGTCCCGGG + Intronic
948987311 2:241533343-241533365 CCTCCTTAGCACAGGGCCCCAGG + Intergenic
949027137 2:241771700-241771722 TGGCCTCAGCTCAGGGGCCCTGG - Intergenic
949051238 2:241898697-241898719 CAGGCACAGCCCAGGGACCCAGG - Intronic
1170149513 20:13215164-13215186 CAGCATCAGGACAAGAGCCCAGG - Intergenic
1170554801 20:17506246-17506268 CAGCCTCTGGACAAGGGCCCAGG + Intronic
1170808887 20:19658154-19658176 AGACCTCAGCAGAGGGGCCCTGG + Intronic
1170835242 20:19878302-19878324 CAGAGTCAGCCCATGGGCCCAGG - Intergenic
1171481901 20:25460738-25460760 GAGCCTCTGCACAGGGCGCCAGG + Intronic
1171522074 20:25783665-25783687 CAGGCCCACCACAGGAGCCCTGG + Intronic
1171529825 20:25845610-25845632 CAGGCCCACCACAGGAGCCCTGG + Intronic
1171554753 20:26072218-26072240 CAGGCCCACCACAGGAGCCCTGG - Intergenic
1172106770 20:32521805-32521827 CAGTCTCAGCCCAGGGAACCTGG - Intronic
1172175682 20:32970627-32970649 CAGCCTCAAGCCAGGGGCTCAGG - Intergenic
1172876076 20:38165147-38165169 CAGCCGCCACTCAGGGGCCCCGG - Intronic
1173503827 20:43571862-43571884 CAGGAGCAGCACAGGGGGCCGGG - Intronic
1173657628 20:44711363-44711385 CAGCCCCCACACAAGGGCCCAGG - Intergenic
1174110380 20:48194326-48194348 GGGTCTCAGCAGAGGGGCCCAGG + Intergenic
1174171409 20:48620186-48620208 GGGTCTCAGCAGAGGGGCCCAGG - Intergenic
1174525205 20:51164938-51164960 GAACCTCAGCATAGGGGCCAGGG - Intergenic
1175142706 20:56872761-56872783 CAAGCTCAGTACAGGGCCCCAGG + Intergenic
1175259416 20:57665171-57665193 GAGGCTCAGCTCAGTGGCCCCGG - Intronic
1175264650 20:57695335-57695357 CAGCCCCAGCCAGGGGGCCCAGG - Intronic
1175892169 20:62320763-62320785 CAGCCTGTGCAGACGGGCCCAGG + Exonic
1175996069 20:62812881-62812903 CAGCCTCAGGACGGGGACCCAGG + Exonic
1176223042 20:63979125-63979147 CAGCCTGGACACAGGCGCCCCGG + Intronic
1176380807 21:6111359-6111381 CAGCCACCGCGCAGGGTCCCTGG + Intronic
1176603915 21:8814421-8814443 CAGCCCCTGCACTGGGCCCCGGG - Intergenic
1176618000 21:9038391-9038413 CAGCCCCTGCACTGGGCCCCGGG - Intergenic
1176618156 21:9039023-9039045 CAGCCCCTGCACCGGGCCCCAGG - Intergenic
1176655878 21:9588653-9588675 CAGGCCCACCACAGGAGCCCTGG + Intergenic
1178457734 21:32771443-32771465 CGGCCTCAGCCCCGAGGCCCGGG + Exonic
1178581825 21:33844721-33844743 CCGCCCCAGCAGAGGGGACCAGG + Intronic
1179085692 21:38215733-38215755 GAGCCCCAGCAGAGTGGCCCAGG + Intronic
1179117491 21:38507443-38507465 CAGTGTCAGCACTGGGGCTCCGG - Intronic
1179742665 21:43426881-43426903 CAGCCACCGCGCAGGGTCCCTGG - Intronic
1179909980 21:44442435-44442457 CAGCCTCGTCCCAGGGTCCCTGG - Exonic
1179961334 21:44768417-44768439 GTGCCTCAGCACAGGCCCCCAGG - Intergenic
1180000504 21:44993395-44993417 CAGCCTCAGTTCGGGGGTCCTGG - Intergenic
1180072142 21:45441898-45441920 CGCCCTCAGCACAGGGTCCATGG + Intronic
1180109486 21:45641537-45641559 CAGCTCCAGCACAGCAGCCCTGG + Intergenic
1180151054 21:45948116-45948138 CAGCCTCAGGAGAGGGGCTAGGG - Intergenic
1180346199 22:11705998-11706020 CAGCCCCTGCACTGGGCCCCGGG - Intergenic
1180981484 22:19880053-19880075 CAGCCACTGCTCAGGGCCCCTGG + Intronic
1181084372 22:20432503-20432525 CAGCCTCTGGACAGGGGGACGGG + Intronic
1181164065 22:20974112-20974134 CAACATCAGCACTGGGGACCTGG + Exonic
1181424125 22:22822162-22822184 CAGGCTCAGGACTGTGGCCCTGG + Intronic
1181431135 22:22882519-22882541 CAGCCTCTGCAGAGCAGCCCAGG + Intronic
1182413592 22:30206859-30206881 CAGTTGCAGCACAGTGGCCCTGG - Intergenic
1182443368 22:30376746-30376768 CAGCCTCAGCCCTGGGCCACAGG - Exonic
1182688850 22:32141910-32141932 CAACATCATCACCGGGGCCCAGG - Intergenic
1182714724 22:32348393-32348415 CAGACTCAGCACAGAAGGCCAGG - Intergenic
1183087090 22:35493007-35493029 CATCCTCAGCACAGGGCACAGGG + Intergenic
1183494626 22:38135627-38135649 CAGCCTCAGAGCAGAGGCCCCGG + Intronic
1183495286 22:38139853-38139875 CAGCCTCAGAGCAGAGGCCCCGG - Intronic
1183525028 22:38317574-38317596 CAGCCTCAGTGCAGGCGCGCGGG + Intronic
1183668058 22:39256463-39256485 CAGCCTCAGCAGAGGCCCCGGGG + Intergenic
1184369942 22:44075925-44075947 CAACCTCAGGGCAGGGGCCTGGG - Intronic
1184489117 22:44799144-44799166 CAGGCCCAGCACAGGGGCGGGGG - Intronic
1184550841 22:45203401-45203423 CAGGCTGAGGACAGGGCCCCAGG + Intronic
1184607245 22:45581229-45581251 CAGCCATAGCCCAGGGGCCCGGG - Intronic
1184689402 22:46110611-46110633 CAGCCTCAGCTCAGAGGAGCTGG + Intronic
1184784038 22:46663213-46663235 CAGCCTCAGCCCAGGGACCGGGG - Intronic
1184827991 22:46966007-46966029 TACCCTCAGCACAGGGCCCCAGG - Intronic
1184872949 22:47252285-47252307 AAAACTCAGCTCAGGGGCCCTGG - Intergenic
1185036370 22:48479277-48479299 CATCCTCAGCTCACGGGTCCTGG - Intergenic
1185036388 22:48479343-48479365 CATCCTCAGCTCACGGGTCCTGG - Intergenic
1185036404 22:48479409-48479431 CATCCTCAGCTCACGGGTCCTGG - Intergenic
1185036456 22:48479607-48479629 CATCCTCAGCTCACGGGTCCTGG - Intergenic
1185070545 22:48653461-48653483 CAACTTCACCACAGTGGCCCTGG - Intronic
1185173691 22:49307383-49307405 CAGGCTCAGCAGAGGGGGCTGGG + Intergenic
1185208069 22:49551569-49551591 CAGCTTCAGCACAGGCCCTCGGG + Intronic
1185398161 22:50603161-50603183 CAGCAGTAGCCCAGGGGCCCAGG - Intronic
1185398988 22:50606310-50606332 CAGCCTCAGTACTGGTGCCTGGG - Intronic
1185419720 22:50728657-50728679 CAGCCCCAACAAAGTGGCCCTGG - Intergenic
950479679 3:13236702-13236724 CAGCCCTAGCACAGGGGCCCGGG - Intergenic
950609765 3:14118578-14118600 AACCCTCAGCACACGGGGCCAGG + Intronic
952956667 3:38562059-38562081 CAGCAGAAGCACAGGGGCCCTGG + Intronic
954107701 3:48418232-48418254 CAGCCTCACCACAGGCCTCCCGG + Exonic
954639761 3:52090896-52090918 CAGCCTCTTCACATGGGGCCAGG - Intronic
954681332 3:52347566-52347588 CAACCTCAGCACAGGGGTGGGGG + Intronic
954707983 3:52491244-52491266 AAGCCTCAGCCCAGAGGCCAGGG - Intronic
954715218 3:52523563-52523585 CAGACTCACCACAGGGGCCCAGG - Exonic
956740274 3:72270261-72270283 CAGCCCCACCCCAGTGGCCCGGG - Intergenic
956990087 3:74752271-74752293 CTGCAGCTGCACAGGGGCCCAGG + Intergenic
960036190 3:113105174-113105196 CAGCTTCAGCCCAGGGGCTCTGG - Intergenic
960269515 3:115658805-115658827 AAGCGTCAGCCCAGGGCCCCAGG + Intronic
960582743 3:119294678-119294700 CGGCCTCGGCACGGCGGCCCCGG + Exonic
961039008 3:123663895-123663917 CAGGCTCAGCAGAGGGGCCAAGG - Intronic
961452376 3:127008209-127008231 CAGCCCCCACACAGAGGCCCAGG - Intronic
961641056 3:128365072-128365094 CTGATTCAGCACAGGGGCCACGG - Intronic
961652186 3:128422157-128422179 CAGCCTCAGAGCACTGGCCCAGG - Intergenic
962271081 3:133978565-133978587 CTGCCACAGGACAGGGGCCCGGG + Intronic
962343974 3:134606500-134606522 CAGCCTCAGCTGAGGGGTCCGGG - Intronic
963038306 3:141051154-141051176 CCGCCTTGGCACAGGGGCGCGGG + Intergenic
963119397 3:141763509-141763531 TAGGCACAGCACTGGGGCCCTGG - Intergenic
964504166 3:157380277-157380299 CATCCTCTGCACTGGGGCCAGGG + Intronic
964520717 3:157563635-157563657 CACACACAGCACAGGGACCCTGG + Intronic
964861543 3:161207891-161207913 CTGCCTCAGCAGAGTGACCCCGG - Intronic
964892278 3:161551580-161551602 CAGCCGTAGCTCATGGGCCCAGG + Intergenic
965060048 3:163773518-163773540 CAGCTTAAGCACAGGGCACCAGG - Intergenic
965634903 3:170770952-170770974 GAGCCTCAGCACAAGGGGACAGG + Intronic
966720291 3:183055613-183055635 CAGGCTGAGCACAGTGGCTCGGG + Intronic
967270478 3:187728564-187728586 CAGCCTCAGCACCTGGGGCAGGG + Intronic
967850095 3:194075891-194075913 CTGCCTCAGCACATGGGTTCAGG + Intergenic
967873569 3:194251529-194251551 CCACCCCACCACAGGGGCCCTGG - Intergenic
967990689 3:195128200-195128222 CAGCCTCAGTACAGCCCCCCAGG + Intronic
968140343 3:196250977-196250999 CAGCCTCAGCATAGGGTATCTGG - Intronic
968427217 4:531998-532020 CAGCCTCAAAACAGGGGCCACGG - Intronic
968501603 4:952742-952764 CACACACAGCACAGGGCCCCGGG - Intronic
968613604 4:1567769-1567791 CAGCCCCAGCCCAGGGCCCCCGG + Intergenic
968705928 4:2077480-2077502 CAGCCTCTGGCCAGGGGCCGTGG + Intronic
968817658 4:2830054-2830076 CAGCTTCAGCGCAGGAGGCCGGG - Exonic
969240190 4:5892486-5892508 CTGCCCCAACACCGGGGCCCGGG + Intronic
969269080 4:6086537-6086559 CAGGCTCAACACAGTGGGCCGGG + Intronic
969461959 4:7333671-7333693 TAGCCCAAGCCCAGGGGCCCAGG + Intronic
969682225 4:8649748-8649770 CAGCCTCTGCCCGGGGCCCCCGG + Intergenic
969688351 4:8689440-8689462 CACCCTCAGCTCATGGGCTCTGG + Intergenic
970050762 4:11912521-11912543 CATGCTCAGCACAGCGGCCAGGG - Intergenic
970332747 4:15002728-15002750 TCGCCGCAGAACAGGGGCCCAGG - Exonic
970733840 4:19142110-19142132 GAGCCTCAGCTCAGGGACCAAGG - Intergenic
972646856 4:40976686-40976708 CAGACACAGCACTGGGGCTCAGG + Intronic
974215515 4:58841814-58841836 TGCCCACAGCACAGGGGCCCTGG - Intergenic
977197529 4:94081530-94081552 CAGCCTCAGGACATGGTGCCTGG - Intergenic
978654737 4:111052011-111052033 CACACACAGCACAGGGACCCTGG - Intergenic
979451414 4:120875323-120875345 CATCCTCAGCACAGTGCTCCAGG - Intronic
980794520 4:137663462-137663484 GAGGCCCAGCAGAGGGGCCCTGG - Intergenic
980857054 4:138453161-138453183 GGGCCTCAGGACAGGGGGCCAGG - Intergenic
982055845 4:151548189-151548211 CAGCACCAGCACTGGGACCCAGG + Intronic
982753754 4:159194089-159194111 GAGCCTCAGCAAAGGGGCTGTGG + Intronic
985754902 5:1707742-1707764 CAGTCTGCACACAGGGGCCCAGG + Intergenic
985866614 5:2519246-2519268 AAGCCTCAGCCCTGGGTCCCTGG + Intergenic
985889752 5:2706141-2706163 CAGCTGCAGCTCAGGTGCCCCGG + Intergenic
985964466 5:3329526-3329548 CAGCCTCTGCAGAGTGGCCTGGG - Intergenic
986439025 5:7762399-7762421 CAGTCAGAGCTCAGGGGCCCAGG - Intronic
987222226 5:15802495-15802517 CCGCCTCAGGACAGTGGCACTGG + Intronic
992169166 5:74085147-74085169 CTGCCTCAGCACACAGGCACTGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
995198672 5:109401311-109401333 CAGCCTGGGCACAGTGGCTCAGG + Intronic
998374440 5:141681840-141681862 GAGGCTCAGCACGCGGGCCCTGG - Intronic
999274379 5:150319259-150319281 AAGCCTCACCTCAGGGGCCTGGG - Intronic
999331539 5:150676815-150676837 CAGCTTCAACAGAGTGGCCCAGG + Exonic
999432236 5:151534472-151534494 CAGCCACAGCACAGTGGCTGGGG + Exonic
1001684303 5:173581917-173581939 GGGCCTCAGCCCAGGAGCCCTGG + Intergenic
1002379760 5:178818190-178818212 CTTCCCCAGGACAGGGGCCCAGG + Intergenic
1002561155 5:180083204-180083226 CTGGCTCAGCTCAGGGGCCCAGG - Intergenic
1003502600 6:6714709-6714731 CAGCCCCAGCCCCGGGTCCCAGG - Intergenic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1006650831 6:35549919-35549941 CAGCCTTTGCCCAGGGGCTCTGG - Intergenic
1006738492 6:36291794-36291816 CAGGCTTAGCGCAGGGGGCCGGG - Intronic
1007264241 6:40585367-40585389 CAGCATCAGCAGAAGGGCCCAGG + Intronic
1007269442 6:40624897-40624919 CAGCCCCAGCCCTGGGGACCAGG - Intergenic
1007707389 6:43799185-43799207 CAGCCCCATCCCAGGGGCCCAGG - Intergenic
1007962797 6:45975994-45976016 GAGCATCAGCACAGGAACCCAGG - Intronic
1009638713 6:66302321-66302343 CAGGCCCAGCACAGTGGCTCTGG + Intergenic
1015347784 6:132180062-132180084 CAGACACAGCACAGAGGCCATGG + Intergenic
1018179091 6:161205013-161205035 CAGCCTCACCACTGGGGACTGGG + Intronic
1018582535 6:165319498-165319520 GGGCCTGAGCACAGGGGCTCAGG - Intergenic
1018841158 6:167518106-167518128 CAGCCTCAGCCCAGAGGACAGGG + Intergenic
1018901249 6:168052812-168052834 CAGCCTGTGCCCAGTGGCCCGGG + Intergenic
1019277118 7:181660-181682 CAGCCTCAGGACAGATGTCCAGG + Intergenic
1019292253 7:256512-256534 CAGCCTCAGCGCCGCAGCCCGGG + Intronic
1019417872 7:935532-935554 GAGGCTCAGCCCAGGGACCCCGG + Intronic
1019451614 7:1101603-1101625 CAGCCTCCGCGCAGCCGCCCAGG + Intronic
1019520347 7:1458092-1458114 CAACCTCAGAGCAGGGGCCGAGG + Intronic
1019559975 7:1651091-1651113 CAGCCTCAGCTTAGGGGTCCTGG - Intergenic
1019597167 7:1863521-1863543 CAGCCTCAGTACTGGCTCCCGGG - Intronic
1019689121 7:2400179-2400201 CAGACTTTGCAGAGGGGCCCAGG + Intergenic
1019811016 7:3165128-3165150 CAGCACCTGCCCAGGGGCCCTGG - Intronic
1019979054 7:4607522-4607544 CAGCCACGGCACAGAGGCCGTGG - Intergenic
1020049605 7:5072828-5072850 CAGCGACAGCACAGAGGACCAGG + Intronic
1020098660 7:5382330-5382352 CAGCCCCAGCCCAGGGCCCATGG + Intronic
1021638835 7:22718543-22718565 CAGCAGCAGCCCAGGGGCCTAGG - Intergenic
1021650972 7:22832692-22832714 AAGATTCAGCACAGGGACCCAGG + Intergenic
1021697348 7:23287684-23287706 GATCCCCAGCACAGGGCCCCGGG - Intergenic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1022896234 7:34752519-34752541 CAGCCTTCGTACAGGGGCACTGG + Intronic
1024524532 7:50336885-50336907 CAGCAGGACCACAGGGGCCCTGG + Intronic
1024801765 7:53087477-53087499 GAGACTCAGCACAGAGGCCTGGG + Intergenic
1025020637 7:55476750-55476772 GAGCCTCAACACAGGGCACCAGG + Intronic
1025302155 7:57826570-57826592 CAGGCCCACCACAGGAGCCCTGG - Intergenic
1026867476 7:73832457-73832479 CCGCTTCAGCCCAGGGCCCCTGG + Exonic
1027198585 7:76048205-76048227 CAGCTTCAGCACCTCGGCCCAGG + Exonic
1029127329 7:98303619-98303641 CCGCCACCGCACAGAGGCCCTGG - Intronic
1029371540 7:100154003-100154025 CTGCCTCATCACAGAGGCCCAGG - Exonic
1029425276 7:100490573-100490595 GAGCGTGAGGACAGGGGCCCTGG + Exonic
1029452018 7:100646709-100646731 GAGGCTCGGCAAAGGGGCCCAGG - Intronic
1030754700 7:113273247-113273269 CAGCCTCAGGACACGGTACCTGG - Intergenic
1031965690 7:128026753-128026775 CAGCCTCAGCTCCTGGGACCTGG - Intronic
1032078672 7:128848081-128848103 CAGCCGCAGCACAGGAGCCCAGG - Intronic
1032125191 7:129188587-129188609 CAGCCTCGGCGCAGGGGGGCCGG + Intergenic
1034467859 7:151240296-151240318 CTGCCCCAGCCCCGGGGCCCTGG - Intronic
1034622010 7:152463849-152463871 CCGCCTCAGCCCAGAGGACCCGG - Intergenic
1035282145 7:157785161-157785183 CAGGCTCTCCACAGGGGCTCTGG + Intronic
1035488673 7:159252939-159252961 CAGCCACAGAACGGGGGTCCTGG - Intergenic
1035488811 7:159253908-159253930 CAGACTCAACCCAAGGGCCCAGG + Intergenic
1035521830 8:280737-280759 CAGCGTCAGTAGAGTGGCCCTGG + Intergenic
1035607371 8:938769-938791 GTGTCTCAGCACAGGGGCCACGG + Intergenic
1037176768 8:15956637-15956659 TAGCATCAGCAGAGGGGCCTGGG + Intergenic
1037769288 8:21789388-21789410 CAGCCTCAGCTCAGCTCCCCAGG - Intronic
1037819632 8:22129432-22129454 CAGCCTCCGCTGAGGGGCACTGG - Intronic
1037855320 8:22367356-22367378 CAGCCTCACCGCAAGGTCCCAGG - Exonic
1037889888 8:22618510-22618532 CTGCCCCAGCACATGGGCACAGG + Intronic
1038491335 8:27974051-27974073 CATCCTCAGCTCAGGGTGCCAGG - Intronic
1039078130 8:33710779-33710801 CATCCTCAGGGCAGGGTCCCGGG + Intergenic
1039890578 8:41682938-41682960 CAGCCTCCCCTCAGGGGACCTGG - Intronic
1040276745 8:46017747-46017769 CAGCCTCTGCACTGGGTCCATGG - Intergenic
1043390334 8:79785541-79785563 CAGCGGCAGCACAGGGCTCCAGG + Intergenic
1044985559 8:97753627-97753649 CAGCGTGAGCACAGGAGGCCTGG + Intergenic
1047003683 8:120597774-120597796 CAGCATCAGGACACAGGCCCCGG + Intronic
1047172416 8:122506655-122506677 GAGCCTCAGCACAGTGCTCCAGG + Intergenic
1047732396 8:127737773-127737795 CAGCCGCAGCGGAGGGGCCCCGG + Intronic
1049036106 8:140077513-140077535 CTGCCTCAGCCCTGGGGCTCAGG - Intronic
1049218096 8:141416947-141416969 TACCCCCAGCACAGGGTCCCTGG - Intronic
1049268762 8:141683273-141683295 CGGCCACAGCACAGGGGCTGGGG + Intergenic
1049320025 8:141991357-141991379 CAGCCTCAGGCCAGAGGCCCAGG + Intergenic
1049358888 8:142202457-142202479 CAGGCTGAGCACCGGGGGCCTGG + Intergenic
1049369063 8:142254862-142254884 CAGCTTCAGCACCAGAGCCCCGG - Intronic
1049391129 8:142372268-142372290 CAGCCTCAGCTCCTGGGACCTGG + Intronic
1049403430 8:142440967-142440989 CACGCTCAGCACAGAGTCCCCGG - Intergenic
1049435171 8:142583198-142583220 AGGCCTCAGCCCAGTGGCCCAGG - Intergenic
1049480922 8:142822202-142822224 CCTCCTTACCACAGGGGCCCTGG + Intergenic
1049594225 8:143476059-143476081 GAGCCTCAGCCCAGGTGCCAAGG - Intronic
1049611668 8:143558778-143558800 CAGCCCCTCCACAGTGGCCCAGG + Intronic
1049775037 8:144400178-144400200 CAGCCTCACCACAGGAACCACGG - Exonic
1049787384 8:144457499-144457521 CAGCATCTGCAGAGGGGCCTGGG - Intronic
1050031105 9:1386610-1386632 CAGCCTCAGCTCATTGGTCCAGG - Intergenic
1052289555 9:26826444-26826466 TTGCCTCAGCACAGGGGACATGG - Intergenic
1052789931 9:32865890-32865912 CACCATCAGCACAGAGGCACAGG + Intergenic
1053607801 9:39678902-39678924 CAGCCAAAGCCCACGGGCCCAGG + Intergenic
1054245734 9:62663507-62663529 CAGCCAAAGCCCACGGGCCCAGG - Intergenic
1054350369 9:64014182-64014204 CAGCCCCTGCACTGGGCCCCAGG - Intergenic
1054559859 9:66698038-66698060 CAGCCAAAGCCCACGGGCCCAGG - Intergenic
1055612006 9:78032360-78032382 CTGCCTCAGCCCACCGGCCCGGG + Intergenic
1056108589 9:83372265-83372287 CACCCTCCTCACAGGGTCCCAGG + Intronic
1056911972 9:90709303-90709325 CAGCTTCAGAGAAGGGGCCCCGG - Intergenic
1057302226 9:93893641-93893663 CAGGCTCAGCCCAGAGGCACTGG + Intergenic
1057333985 9:94141920-94141942 CGGCCTCTGGACAGGGGCGCAGG + Intergenic
1057368898 9:94451886-94451908 CCTCCTCAGCTCAGGGGCCCTGG + Intronic
1058486648 9:105448301-105448323 CACCCACAGCCCACGGGCCCAGG - Intronic
1058802403 9:108557554-108557576 CAGCCTTAGCAGAGGTGCCCTGG - Intergenic
1060026233 9:120174358-120174380 CAGACTCAGCACCGGGACCTTGG + Intergenic
1060413574 9:123415500-123415522 CAGCCTCAGCTCTGGTCCCCAGG - Intronic
1060665236 9:125428652-125428674 CAGCCTCCCCACAGGTGCCTGGG - Intergenic
1060783349 9:126430119-126430141 TAGCCTCAGCCCAGTTGCCCAGG + Intronic
1060802099 9:126551356-126551378 CACACTGAGCACACGGGCCCTGG + Intergenic
1061006250 9:127929861-127929883 CAGCCTCAGGGGAGGGGGCCAGG + Exonic
1061480006 9:130893125-130893147 CAGCCTCAGCTCCGTGCCCCTGG + Intergenic
1061484632 9:130914141-130914163 TAGCCACAGCACTGAGGCCCAGG + Intronic
1061868127 9:133505927-133505949 CAGCCTCAGACCACCGGCCCTGG - Intergenic
1061874467 9:133536963-133536985 CAGCCTCTGAACTGGGGCCCTGG + Intronic
1062042506 9:134410637-134410659 ACGCCTGGGCACAGGGGCCCCGG - Intronic
1062048461 9:134435241-134435263 CAGGCCGTGCACAGGGGCCCTGG + Intronic
1062143144 9:134971334-134971356 CAGCGTCATCAGACGGGCCCTGG + Intergenic
1062186781 9:135222457-135222479 CAGCCACAGTACTGGGCCCCTGG + Intergenic
1062204163 9:135326495-135326517 CAGGCTCTGGACAGAGGCCCTGG + Intergenic
1062268202 9:135696935-135696957 CAGCCTCTGCCCAGGGGCCCTGG + Intronic
1062290040 9:135790322-135790344 CAGCCTCAGCATGAGGCCCCTGG + Intronic
1062410764 9:136423036-136423058 CAGCCTCAGCGTGGGGGCCGTGG + Intronic
1062501734 9:136854716-136854738 CAGCCACAGCCCAGTGGCCCTGG + Intronic
1062556294 9:137114678-137114700 CAGCAGCAGGACCGGGGCCCAGG + Exonic
1062606478 9:137350884-137350906 CAGGCTCTGCTCTGGGGCCCTGG + Intronic
1062708250 9:137957116-137957138 CAACCACAGCAGTGGGGCCCGGG - Intronic
1203697875 Un_GL000214v1:114406-114428 CAGCCCCTGCACTGGGCCCCAGG + Intergenic
1203633595 Un_KI270750v1:92114-92136 CAGGCCCACCACAGGAGCCCTGG + Intergenic
1190108296 X:47574104-47574126 CAGCCTCGGCCCAGCGGCCCGGG - Exonic
1190335119 X:49257521-49257543 CACCTGCAGCACAGGGGTCCGGG + Exonic
1191251159 X:58260843-58260865 CAGGCCCAGCACAGGGGCTGTGG - Intergenic
1192359873 X:70432703-70432725 CAGCCTCATCACCAGGGCCCTGG - Intronic
1192503032 X:71665644-71665666 AAGCCTAAGCACAGCAGCCCTGG - Intergenic
1192510236 X:71717019-71717041 AAGCCTAAGCACAGCAGCCCTGG - Exonic
1192516461 X:71764534-71764556 AAGCCTAAGCACAGCAGCCCTGG + Exonic
1192529362 X:71872160-71872182 AAGCCTAAGCACAGCAGCCCTGG - Intergenic
1197620196 X:128739277-128739299 CAGAGTCAGGACAGGGACCCAGG - Intergenic
1198310242 X:135422553-135422575 CGGTCTCAGCCCGGGGGCCCTGG + Intergenic
1199434411 X:147796990-147797012 TTGCCTGAGCACAGGGGCCCTGG + Intergenic
1200053064 X:153444935-153444957 CAGCCACGGCACCCGGGCCCGGG - Exonic
1200080786 X:153575422-153575444 CAGCCACAGCAAAGGTCCCCAGG + Intronic
1200601234 Y:5208114-5208136 CTGCCTCCGCACAGCAGCCCCGG - Intronic
1201151379 Y:11097226-11097248 CAGCCCCTGCACTGGGCCCCGGG - Intergenic
1201151545 Y:11097860-11097882 CAGCCCCTGCACTGGGCCCCAGG - Intergenic