ID: 1124583709

View in Genome Browser
Species Human (GRCh38)
Location 15:30986011-30986033
Sequence ATTTTTCAGAGGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 0, 3: 52, 4: 414}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124583709 Original CRISPR ATTTTTCAGAGGATGGTGGA AGG Intronic
901255234 1:7819306-7819328 GTTTTTCAGTGTTTGGTGGAAGG - Exonic
902669060 1:17959590-17959612 ATTTCTCAGGTGATGGAGGATGG + Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
905313107 1:37064352-37064374 ATTTCTGAGAGGCTGCTGGAAGG + Intergenic
906850046 1:49238471-49238493 ATTCTTAAGTGGGTGGTGGAAGG + Intronic
906949784 1:50324940-50324962 ATTTTTCAGAGGATGCATGATGG + Intergenic
908990676 1:70084542-70084564 ATTTATCAGTTGATGGTTGATGG + Intronic
911797283 1:102090951-102090973 ATTTTGCTGAGGATGGTGTAAGG + Intergenic
912062586 1:105691040-105691062 ATTTTTCATGGGATAGGGGAGGG - Intergenic
912102128 1:106222704-106222726 ATTTTTCAGAGGATCATAGAGGG - Intergenic
912553559 1:110499999-110500021 ATTTATAAGAAGATGGTGGGAGG - Intergenic
912676925 1:111690472-111690494 ATTTTTCAGACTGTGGTGAAGGG - Intronic
913118386 1:115717445-115717467 GTTTTTAAGAGGATCATGGAAGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916317952 1:163471266-163471288 ATGTTTCAAAGGATGTAGGAGGG + Intergenic
917031871 1:170701987-170702009 ATTTTTCCATGGATGGGGGAAGG + Intronic
918475503 1:184919905-184919927 TTTTTTCAGGGGCTGGGGGAGGG + Intronic
920545605 1:206814371-206814393 ATTCTGCAGAGGATAATGGAGGG + Intronic
920801632 1:209193962-209193984 ATATTAGAGAGAATGGTGGAGGG + Intergenic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921720124 1:218462262-218462284 TTTTTTCAGAGGCTGGTTGTTGG + Intergenic
921925682 1:220708383-220708405 TCTTCTCAGAGGATGGGGGATGG - Intergenic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922421373 1:225463018-225463040 ATTTTTAAGGGGATCATGGAGGG - Intergenic
922568713 1:226619084-226619106 CTTTTTCAAAGGATTCTGGATGG - Intergenic
924183390 1:241461975-241461997 AGTTATCAGAGGAGAGTGGAGGG - Intergenic
924630994 1:245740706-245740728 ACTTATCAGAGGGTGGTGGGAGG + Intergenic
1063203892 10:3812183-3812205 AGCTGTCAGTGGATGGTGGAGGG - Intergenic
1063690572 10:8283297-8283319 TTTTTTCTGATGCTGGTGGAAGG - Intergenic
1064178411 10:13095413-13095435 ATTTTTCCATGGATGGTGGTGGG + Intronic
1064675464 10:17755698-17755720 AATTTTGAGGGAATGGTGGAAGG + Intronic
1064715943 10:18176772-18176794 ATGTTTCAGAGAATGCTGGGTGG + Intronic
1065386618 10:25140153-25140175 ATTTTTCAGAAGACAGTTGAAGG - Intergenic
1066285743 10:33964419-33964441 ATTTTTAGGAGGATGCTAGAAGG + Intergenic
1066320890 10:34302796-34302818 ATTTTTCAGAAGAAGGCAGATGG + Intronic
1068272149 10:54742328-54742350 ATTTTTCATAAGATGATGGCTGG + Intronic
1068618332 10:59147046-59147068 ATTTTTCAGTGGATAGAGGTAGG + Intergenic
1068953359 10:62800573-62800595 ATTTTTAAGAGGTTGGTGGTGGG - Intergenic
1069140060 10:64811263-64811285 ATTTCTCATAGAGTGGTGGAAGG + Intergenic
1069175133 10:65280902-65280924 ATTTCTAAGAGGATCATGGAGGG + Intergenic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069818183 10:71211859-71211881 ATTTTACAGATGATGATGAAGGG + Intergenic
1070195423 10:74151763-74151785 ATTTTTCAGAGTGTTGCGGAAGG + Intronic
1070380265 10:75875054-75875076 ATTATCCAGGGGCTGGTGGATGG - Intronic
1070992222 10:80742456-80742478 ATTTTTCTAAGAATGGTGTAAGG - Intergenic
1071174993 10:82916005-82916027 TTTGTTCAGAGAATGGAGGAAGG + Intronic
1071376908 10:85015247-85015269 GCCTTTCAGAGGATGGTGGTTGG + Intergenic
1071888342 10:89975062-89975084 ATTTTCCAGAGTATGGTACATGG + Intergenic
1072113046 10:92341957-92341979 TTTTTTCTAAGGATGGTGGGAGG + Intronic
1072852794 10:98914244-98914266 ATTTTTACGTGGATGGTGGCAGG - Intronic
1073498501 10:103915797-103915819 ATTTTTCCGGGGATGGGGGTTGG + Intronic
1073727832 10:106254894-106254916 ATTTTTCAGATGTTGGTCAAAGG + Intergenic
1076374921 10:129977019-129977041 ATTTTTCAGAGAAAGGTGTCAGG + Intergenic
1076992928 11:284947-284969 GTTTGTCAGAGGCTGGGGGAGGG - Intronic
1077749895 11:4955312-4955334 GTATCTCAGAGGATTGTGGATGG + Exonic
1078902799 11:15656907-15656929 ATTTTTGAGAGGGTGTAGGAGGG + Intergenic
1079551331 11:21702333-21702355 ATTTGTCTGAAGATGGGGGAAGG - Intergenic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080172259 11:29319062-29319084 ATATTTCAGAGAATGATGTATGG + Intergenic
1081110910 11:39132059-39132081 GTTTTAAAGGGGATGGTGGAAGG - Intergenic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082955973 11:58870179-58870201 ATTTTTAATAGGATGGTCAAAGG + Intronic
1083381157 11:62269740-62269762 AACTTTCAGCGGAGGGTGGATGG + Intergenic
1083703982 11:64500512-64500534 ATTTTCCAGATGGTGGGGGATGG + Intergenic
1084711510 11:70846794-70846816 ATTTTTCAGAGAAGGGTGGGAGG - Intronic
1086038420 11:82444922-82444944 ATTTTGCAGATTCTGGTGGATGG - Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1088257456 11:107915033-107915055 AATTAGCAGAGGATGGTGGTGGG - Intronic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1092586687 12:9907914-9907936 ATTTTGCTGAGGATGGTGTAAGG + Intronic
1092623596 12:10301468-10301490 AATTTTTAAAGGATTGTGGAGGG - Intergenic
1094417294 12:30230871-30230893 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094761611 12:33539769-33539791 ATTTTTCATAAGATGTTTGAAGG - Intergenic
1096716458 12:53494223-53494245 ATTATGCAGAGCATGGGGGAAGG + Intronic
1097605937 12:61754579-61754601 ATTTCTCGGTGGATGGTGGGAGG - Intronic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1099008051 12:77259169-77259191 ATTTTTAATAGGATGGTCAAGGG + Intergenic
1099104281 12:78480286-78480308 ATTTTGCTGAGAATGGTGTAGGG - Intergenic
1099123925 12:78728738-78728760 TTTTATCAAAGGATGGTGAAGGG + Intergenic
1099249380 12:80234429-80234451 ATGTTTTAAAGGATGGTGAAAGG + Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1100200718 12:92295149-92295171 GTTTTTCAGAGCATGCAGGAAGG + Intergenic
1100466807 12:94853390-94853412 ATTTTTCTTATGATGCTGGAAGG - Intergenic
1100746115 12:97647831-97647853 TTTTTTCAGAGAATGCTGGATGG + Intergenic
1100797552 12:98198298-98198320 ATTTCTCATAGGATTGTGGAAGG - Intergenic
1101145862 12:101839851-101839873 ATTTTTAAAAGGACGGAGGAAGG + Intergenic
1101989331 12:109471616-109471638 ATTTTTCTGAGGGAGGTGGCTGG - Intronic
1103186050 12:118958431-118958453 ATTTTTGAGAGTCTGGAGGAGGG - Intergenic
1104068409 12:125324724-125324746 AGTTTTCCATGGATGGTGGAGGG - Intronic
1105325489 13:19367129-19367151 ATTTTTCAAAGGATGAAGGTAGG + Intergenic
1105627468 13:22126838-22126860 ATTATTCAGAGGAAGGAAGATGG - Intergenic
1106819466 13:33447554-33447576 ATTTTCCAGAGGAACGTGTAAGG - Intergenic
1106907591 13:34424925-34424947 ATTTTTCTGAGGCTTGTGGGTGG - Intergenic
1107104436 13:36627942-36627964 ATTTGTCAGAGGAGGTTGGTAGG - Intergenic
1107892901 13:44930041-44930063 ATTTTGTAGAGCATGCTGGAAGG - Intergenic
1108623031 13:52202691-52202713 TTTCTTTAGAGGATGGTAGAGGG - Intergenic
1108663693 13:52608351-52608373 TTTCTTTAGAGGATGGTAGAGGG + Intergenic
1109189263 13:59306045-59306067 ATTTTTCTGTGGACGGAGGATGG - Intergenic
1109956279 13:69571086-69571108 ACTTCTCTGAGGATGGTGGAGGG + Intergenic
1110307120 13:74001228-74001250 GGTTTTGAGAGGCTGGTGGAAGG + Intronic
1110907355 13:80908756-80908778 CTTTTTCAGAAGATGGAGAAAGG + Intergenic
1112416055 13:99204466-99204488 GTCTTTCAGAGGACAGTGGAAGG + Intronic
1112568664 13:100573302-100573324 ATATTTCATGGGATGGGGGAAGG - Intronic
1112587389 13:100731316-100731338 ATTTTTAGGTGGATGGGGGATGG + Intergenic
1113098384 13:106690551-106690573 GTTTATCAGAGGGTGGTGGGGGG + Intergenic
1113281169 13:108789499-108789521 ATTTTGAAGAGGCTGGTGCAGGG - Intronic
1114786272 14:25603457-25603479 ATTTTTAAGAGGATCATGGTGGG + Intergenic
1115026023 14:28747233-28747255 ATTATTCAGATTATGATGGATGG + Intergenic
1115399564 14:32941094-32941116 ATTTCTCAGAGCATTGTGCAAGG + Intronic
1117231686 14:53725490-53725512 CTAATTCAGAGCATGGTGGAAGG + Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117745880 14:58869140-58869162 ATTTTTAAGGGGATGGTCGCTGG - Intergenic
1118056931 14:62088561-62088583 ATTTGTCAGAAGTTGGTGAATGG + Intronic
1118179886 14:63481936-63481958 ATTTTTTAGAAGATGATGGTAGG + Intronic
1118364986 14:65087133-65087155 AGATTTCAGAGGATGGAGTATGG + Intronic
1118396251 14:65339633-65339655 ATTTTTCAATAAATGGTGGATGG - Intergenic
1118676048 14:68185655-68185677 ATTTTTCCGTGGATGGGGGCGGG + Intronic
1118739191 14:68726397-68726419 ACAATTGAGAGGATGGTGGAGGG - Intronic
1120779088 14:88469722-88469744 ATCTTTAACAGGAGGGTGGAAGG - Exonic
1121056290 14:90856829-90856851 GTTTTTCAGGGGCTGGTGGGAGG - Exonic
1123154956 14:106215815-106215837 CATTTTCAGAAGATTGTGGATGG - Intergenic
1123181472 14:106475221-106475243 CATTTTCAGAAGATTGTGGATGG - Intergenic
1124005201 15:25790121-25790143 ATGTTTCAGTTTATGGTGGAAGG - Intronic
1124192683 15:27594245-27594267 CTTTCCCTGAGGATGGTGGAAGG + Intergenic
1124583709 15:30986011-30986033 ATTTTTCAGAGGATGGTGGAAGG + Intronic
1124878221 15:33616359-33616381 ATTTTTTAGAGGGTAGTGGAGGG + Intronic
1126644743 15:50863874-50863896 ATTTTTTAAAGGAAGGGGGAGGG - Intergenic
1126904471 15:53349520-53349542 ATCTTTCAAAAGATGGAGGAAGG + Intergenic
1127362576 15:58257794-58257816 ATTTCCCAGAGGATGCTGGAGGG - Intronic
1127379152 15:58414564-58414586 ATTTCTCACAGGTTTGTGGATGG - Intronic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1128728002 15:70001928-70001950 ATTTTTCAAAGGATGTTAAAAGG - Intergenic
1130550245 15:84885927-84885949 AGTTTGGAGAGGATGGTGGATGG - Intronic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1134022372 16:10929965-10929987 ATTTTTCCGGGCAAGGTGGAAGG - Exonic
1135171617 16:20189101-20189123 GTTTTCCAGAGGCTGGGGGAAGG + Intergenic
1136076111 16:27818309-27818331 AATTATCAAAGGATGGTGGGAGG - Intronic
1136549894 16:30977403-30977425 AGTTCTCAGAGGAAGGTGGTGGG + Intronic
1137064328 16:35823878-35823900 GTCTTTCAGAGGGTGGTGAATGG - Intergenic
1137372672 16:47923051-47923073 CCTTTCCAGAGGATGGAGGATGG - Intergenic
1137507639 16:49068286-49068308 GTTTTTAAGGGGATGGTGGAGGG + Intergenic
1138180139 16:54935581-54935603 AATTTTCAGTGGTTGGGGGAGGG + Intergenic
1138781796 16:59797310-59797332 ATTATTCAGAGGAAGAAGGAAGG + Intergenic
1139466672 16:67157752-67157774 TTTTGTCAGAAGATGGAGGAAGG - Intronic
1139902671 16:70340647-70340669 CGTCTTCACAGGATGGTGGATGG + Intronic
1140119089 16:72067870-72067892 ATTTTGCTGAGAATGGTGTAAGG - Intronic
1140156412 16:72432139-72432161 CTTTTTCAGAGTATAGAGGAGGG - Intergenic
1140725666 16:77809338-77809360 ATTTCTCTGATGATGGAGGATGG - Intronic
1143357938 17:6344570-6344592 ATTTAGCCGAGGATGGTGGCAGG - Intergenic
1144440126 17:15273712-15273734 CTTGCTCAGATGATGGTGGAAGG - Intergenic
1144449364 17:15363148-15363170 ATTTTTAATTGGATGGTGGTAGG + Intergenic
1145274817 17:21423080-21423102 ATTCTCCAGAGGAGGGTGGCAGG + Intergenic
1145312670 17:21708979-21709001 ATTCTCCAGAGGAGGGTGGCAGG + Intergenic
1148474398 17:47917379-47917401 TTTTTTCAGGGGATGGTGAGGGG + Intronic
1150054156 17:61996438-61996460 AGTTTTCATAGGATGGTATAAGG - Intronic
1152268319 17:79309232-79309254 ATTTTGCACAGGAAGGAGGAAGG + Intronic
1152502569 17:80722430-80722452 GTTTTTAAGGGGAGGGTGGAAGG + Intronic
1153060733 18:992393-992415 GTTTTTCAGAGGTTGAAGGAAGG - Intergenic
1153176615 18:2381417-2381439 ATTTTCCAGTGGATGTTGGTAGG + Intergenic
1153656488 18:7287469-7287491 ATTTTCCAGAGGATGGAGCTTGG - Intergenic
1156774664 18:40772372-40772394 ATTTTTCCATGGATGGGGGATGG + Intergenic
1156886569 18:42141843-42141865 ATTTTTCTAAGGATGGTGGCAGG + Intergenic
1156948895 18:42869158-42869180 ATTTTTCTGTGGATGGTGGTGGG + Intronic
1157215221 18:45777016-45777038 ATTTAGCTGAGGATGGTGGTGGG - Intergenic
1157349533 18:46872242-46872264 ATTTTGCTGAGGATAGTGTAAGG - Intronic
1157907413 18:51581738-51581760 GTCTTTCAGAGGATGGAGGGTGG - Intergenic
1158366623 18:56744303-56744325 ATGTTTCTGTGGATAGTGGATGG + Intronic
1159263885 18:66053687-66053709 ATTTTTAAGGGGTTGGTGGAAGG + Intergenic
1159487727 18:69086649-69086671 ATTTTTCAGAAAAGGGAGGAAGG + Intergenic
1160047776 18:75403422-75403444 ATTTTTTAGAGGTTGCTGTAGGG - Intergenic
1162027640 19:7903608-7903630 ATTCTTCTGAGGACGGTGGGCGG - Intergenic
1162744455 19:12790927-12790949 AATTTTCACAGGACGGAGGAGGG - Intronic
1163642966 19:18472271-18472293 ATTTTTCTATGGATGGTGGAAGG + Intronic
1165717424 19:38055484-38055506 AGTTTGCAGGGGATGGGGGATGG - Intronic
1167131923 19:47592481-47592503 AGTTGTCAGATGAGGGTGGAAGG - Intergenic
1167940403 19:52942036-52942058 ATTTTCCAGAGGCTGGTGCAGGG + Intronic
1167987958 19:53334276-53334298 ATTTTCCAGGGGCTGGTGCAGGG - Intronic
925948309 2:8887260-8887282 TTTTTTGAGGGGGTGGTGGAGGG - Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
929909494 2:46076975-46076997 GGTTTCCAGAGGCTGGTGGAGGG + Intronic
930315287 2:49789976-49789998 ATTATCCATAGGATGTTGGATGG + Intergenic
930386582 2:50703432-50703454 TTATTTCAGAAGGTGGTGGAGGG + Intronic
930660158 2:54045246-54045268 GTTTTTAAGGGGATCGTGGAGGG - Intronic
933235502 2:79859736-79859758 CTGTTTCAGAGGCTGGTGAAGGG + Intronic
933644113 2:84796149-84796171 ATCTTTGAGGGGGTGGTGGAAGG + Intronic
935307147 2:101748141-101748163 ATTTTTGAGAGAATGTTGGCTGG + Intronic
935815743 2:106844223-106844245 GTTTTGCAGAGGTTGGTGGGAGG - Intronic
936155806 2:110046862-110046884 CTTTTTCAGAGGAAGTTGGAGGG - Intergenic
936188882 2:110324566-110324588 CTTTTTCAGAGGAAGTTGGAGGG + Intergenic
936542669 2:113364576-113364598 AGGTTAGAGAGGATGGTGGAGGG + Intergenic
937789131 2:125939759-125939781 AATTTTCAGACGGTGGTGCAGGG - Intergenic
938207091 2:129432990-129433012 TCTTGTAAGAGGATGGTGGATGG + Intergenic
938665636 2:133532937-133532959 ATTTTTCAGAGGCTAGAGGGAGG + Intronic
939731893 2:145795056-145795078 ATATTTCAGAGGAGAGTGGATGG - Intergenic
939736019 2:145846522-145846544 ATATATCAGAGCATGCTGGAGGG + Intergenic
940158176 2:150681404-150681426 GTTTTTAAGAGGATCATGGAGGG + Intergenic
940312371 2:152292124-152292146 ATTTTTCCATGGATGGTGGTGGG - Intergenic
940737314 2:157467928-157467950 CTTTCTCAGAGTATGGTGGCTGG - Intronic
941670654 2:168288932-168288954 ATTGTTCAGGGGATGGGGGGCGG - Intergenic
943175271 2:184465133-184465155 ATTTTTGAAAAGAAGGTGGAAGG + Intergenic
943215580 2:185029463-185029485 GGTTTTCAGAGGATGAGGGATGG - Intergenic
943754821 2:191546886-191546908 ATTTTTCAAAAGGTGGTGGGGGG - Intergenic
943757500 2:191571882-191571904 AATTTTCAGAGTTTGGAGGAAGG - Intergenic
943893216 2:193318607-193318629 GTTTGCCAGAGGATGGTGGCTGG - Intergenic
944682239 2:202087664-202087686 AACATTCAAAGGATGGTGGAAGG - Intronic
944755649 2:202759363-202759385 TTTTTTGTGGGGATGGTGGAAGG - Intronic
945891640 2:215436349-215436371 ACTTTTTAGGGGATGGGGGAAGG + Intergenic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
945979730 2:216299454-216299476 ATCTTACAGAGGGTGGTGGTGGG - Intronic
946197606 2:218044591-218044613 GTTTATCAGAGGATGGAGGGTGG - Intronic
946358687 2:219206093-219206115 GTTTTTCAGAGTGTGGTGCATGG + Intronic
946502751 2:220267200-220267222 ATTTTTCCATGGATGGTGGGTGG + Intergenic
947238739 2:227971431-227971453 ATTTTTCAGTGGATCGCAGAGGG - Intergenic
947431222 2:230029800-230029822 GTTTTTCAGAGTATAGAGGAAGG + Intergenic
1169260032 20:4130753-4130775 TGTTTTCAGAGGCTGGGGGAAGG + Intronic
1169441357 20:5636429-5636451 ATTTTTCTTAGAATGCTGGAGGG - Intergenic
1169536746 20:6552311-6552333 ATATATCATATGATGGTGGAAGG + Intergenic
1170710804 20:18788810-18788832 CTTCTTCACATGATGGTGGAAGG + Intergenic
1170822643 20:19767379-19767401 TTTTTACACAGAATGGTGGAGGG + Intergenic
1171166195 20:22974093-22974115 GTTTTTAAGAGGACTGTGGAGGG - Intergenic
1171343782 20:24450685-24450707 ATTCCTCAGAGGAAGGTGGGTGG + Intergenic
1172736331 20:37128593-37128615 ATTTTTTAGAGGATGAGGGAAGG + Intronic
1173093846 20:40004254-40004276 ACCTTTCAGAGGGTGGAGGATGG - Intergenic
1173217741 20:41102024-41102046 ATATTTCATAGTATGTTGGAGGG - Intronic
1174093341 20:48067409-48067431 ATTTTTCAACGCATGGTGGGTGG + Intergenic
1175267433 20:57710864-57710886 ATTTTTAAGAGGCTGGAGGTGGG - Intronic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177486958 21:21770861-21770883 TTTTTTCAGAGGTTGGTGCAAGG + Intergenic
1177675295 21:24290169-24290191 ATATTTCTGAGGAAGGTGGAGGG - Intergenic
1177805660 21:25872351-25872373 CTTTCTCAGAGCATGGTGGCTGG - Intergenic
1177941284 21:27414920-27414942 TATTTGCAGAGTATGGTGGACGG + Intergenic
1178549984 21:33528879-33528901 GTTCTTCAGAGGACAGTGGATGG - Exonic
1181487132 22:23238552-23238574 ATTTTACAGATGAAGGTTGAAGG - Intronic
1182104954 22:27682653-27682675 ATTTTCCAGGGGCTGGTGGCCGG - Intergenic
1182422125 22:30253780-30253802 ATTGTTCTGAGGATTGTGGGTGG + Intergenic
1182917756 22:34051001-34051023 AGCTTTCAGGGGATGATGGAAGG + Intergenic
1184064739 22:42111762-42111784 ATTTTGCTGAGAATGGTGTATGG + Intergenic
949361787 3:3240311-3240333 ACTGTTCAGAAGAAGGTGGAAGG + Intergenic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
953172405 3:40519257-40519279 ATTTTTTAGAGGTTGGTGGGGGG + Intergenic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
954645856 3:52131132-52131154 ATTTGGGAGAGGATGGTGGGCGG - Intronic
954740046 3:52742123-52742145 AATTTCCAGAGGACAGTGGATGG + Intronic
955806691 3:62743637-62743659 AGTCTTCAGAGGATGGTTGAAGG - Intronic
956345336 3:68271704-68271726 ATATTTCAGAGGATGGGAGTTGG + Intronic
956529891 3:70206506-70206528 ATTTTACAGGGGATGGGGGTTGG + Intergenic
956661048 3:71598049-71598071 ATTTTACAGATGATGGAGCAGGG - Intergenic
957449534 3:80360470-80360492 CCTTTTCAGAGGAGGGTAGAGGG + Intergenic
957570099 3:81936033-81936055 ATTTTTCAGAGGAGGAGGTAAGG - Intergenic
957783096 3:84845049-84845071 ATTTTTCCATGGATGGTGCAAGG - Intergenic
957856172 3:85881795-85881817 ATTTTTCCATGGATGGTGGGCGG + Intronic
958529774 3:95311792-95311814 ATTTTTCAGGTTATAGTGGAGGG - Intergenic
959106531 3:102071160-102071182 ATTTTTCCATGGATGGGGGAGGG + Intergenic
959259755 3:104062101-104062123 ATTATTCAGATGGTGGTGGGAGG + Intergenic
959793412 3:110392634-110392656 ATTTTTTAAAGAATGGTTGAAGG + Intergenic
961988437 3:131161673-131161695 ATTTTTCAGAGGGTGGAGGGTGG + Intronic
964897208 3:161612867-161612889 AGATTTCAGAGGATGATGTATGG + Intergenic
964929350 3:161997638-161997660 AGTTTTCAGAGGATGGGAGGAGG - Intergenic
966040441 3:175479460-175479482 ATTTTTCACAAGATGATTGAAGG - Intronic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967489071 3:190068328-190068350 ATATTTCAGAGGATGGGACAAGG - Intronic
967678451 3:192329562-192329584 AATTTACAGAGGATGGTCGAGGG + Intronic
967911502 3:194546060-194546082 ACTCCTCAGAGGATGGGGGATGG + Intergenic
969117495 4:4880414-4880436 CTCTGTCAGAGGACGGTGGAGGG - Intergenic
969659189 4:8516461-8516483 GTTTTTCAGGGAATGGTGAAGGG - Intergenic
970235671 4:13955881-13955903 ATTTTTCCGTGGACTGTGGAGGG - Intergenic
970651896 4:18187927-18187949 CACTTTCTGAGGATGGTGGAGGG - Intergenic
971055606 4:22909569-22909591 ATCTTTCAGAGGATGGAGGGTGG - Intergenic
972423065 4:38907492-38907514 ATTTTTCATAGGATGTTAGCAGG + Intronic
972723244 4:41721881-41721903 ATTTTTCAGAGGGTGGTCCTGGG + Intergenic
973607994 4:52606778-52606800 ACTTTTGACAGCATGGTGGAGGG + Intronic
973901789 4:55482243-55482265 AATTTTTGGAGGAGGGTGGAAGG - Intronic
974076365 4:57172018-57172040 ATATTTCCAAGGATGGTGGTCGG + Intergenic
974140728 4:57883207-57883229 TTTTTACAGGGGAGGGTGGATGG + Intergenic
975083731 4:70311282-70311304 AGTCTTCAGAAGTTGGTGGAAGG + Intergenic
975650916 4:76592056-76592078 ATTTTTTAGGGGGTGGTGGAAGG + Intronic
975719970 4:77239931-77239953 ATTTTTCAGTGGAGGGGTGATGG + Intronic
975908269 4:79241416-79241438 ATTTTTGATTGCATGGTGGAGGG + Intronic
976523028 4:86052333-86052355 AGTTTTCAGTGGATGGGGGGAGG - Intronic
976795430 4:88926855-88926877 ATTTTTAATAGCATGGTAGAGGG - Intronic
976851885 4:89557151-89557173 TCTTTTCAAAGGATGGTAGAAGG - Intergenic
977072869 4:92414481-92414503 ATTTTTCAGATGATAGTCAAAGG + Intronic
978070863 4:104466891-104466913 ACCTTTCAGAGGATGGAGGGTGG + Intergenic
978128209 4:105160153-105160175 AATTTACAGAGGATGGGGAAAGG - Intronic
979006690 4:115307830-115307852 ATTTTTAAGGTGATGGAGGATGG - Intergenic
979268608 4:118732689-118732711 ATTTCCCAGAGGAGGCTGGAAGG - Intronic
979993968 4:127408872-127408894 ATTTTTTAGAGGATGATGAATGG - Intergenic
980268257 4:130548522-130548544 ATTTGGCAGAGAATGGAGGATGG - Intergenic
980379473 4:131993125-131993147 AGTTTTCAGAGGATTGTGAAGGG - Intergenic
982346152 4:154362375-154362397 ATTTTTAAGAGGCTGTAGGAAGG + Intronic
983099384 4:163606350-163606372 ATTGTTCTGAGTATTGTGGAGGG + Intronic
983923747 4:173373187-173373209 ACTGTTAAAAGGATGGTGGATGG - Intronic
984210390 4:176840203-176840225 ATTTGTCGGGGGATGGGGGAGGG - Intergenic
984376856 4:178942364-178942386 ATTTTTCTATGGATGGAGGAAGG - Intergenic
984385269 4:179047845-179047867 ATTTTTCCAGGGATGGTGGGTGG + Intergenic
984692968 4:182749584-182749606 ATATTTCACAGGATGCTGGGAGG - Intronic
984942541 4:184946270-184946292 CTTTTTCAGAAGATGGAGGCTGG - Intergenic
986122794 5:4857610-4857632 ATGTGTCAGAGGGTGCTGGATGG - Intergenic
986524663 5:8660947-8660969 ATTTTGTAGGGGTTGGTGGAAGG - Intergenic
986525339 5:8668067-8668089 CATATTCTGAGGATGGTGGAGGG - Intergenic
987460322 5:18200782-18200804 ATTTATCATAGGATTGTGTAAGG - Intergenic
988392911 5:30658872-30658894 ATTTTTCCATGGATGGTGGAAGG + Intergenic
988494064 5:31729640-31729662 ATTGTTCTGAAGTTGGTGGATGG - Intronic
988641739 5:33048324-33048346 ATTTTTCCATGGATGGTGAAGGG + Intergenic
989266164 5:39476519-39476541 ATTTTACAGACTATGGTGGAGGG + Intergenic
989469210 5:41795415-41795437 ATTTAGCAGAGGATTGTGAAGGG - Intronic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
990028573 5:51226370-51226392 ATGCTTCAGAGGAAGGTGCAAGG + Intergenic
990643016 5:57809574-57809596 ATTTTAAAGATGGTGGTGGAAGG - Intergenic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
990939949 5:61191946-61191968 ATGTTTCAGAGCATCATGGATGG + Intergenic
991363338 5:65843439-65843461 ATTTTTCTAATGGTGGTGGAAGG + Intronic
992211502 5:74484194-74484216 ATTTTTCCATGGACGGTGGAGGG - Intergenic
992285218 5:75227988-75228010 ATTTTTCCCAGGATGGCGGTTGG - Intronic
992759576 5:79939642-79939664 ATTCTGCTGAGGGTGGTGGAAGG - Intergenic
993602584 5:89946911-89946933 ATTTTTCTGAGCATGGGGGTAGG + Intergenic
993885465 5:93410626-93410648 ATTTTTCTGTGGATGGTGTGGGG - Intergenic
994402781 5:99302620-99302642 TGGTTACAGAGGATGGTGGATGG + Intergenic
994798480 5:104338318-104338340 ATTTTTCAGGGGATTGTGTTAGG - Intergenic
995965069 5:117895870-117895892 ATTTTTTATATGATGGTGCAAGG - Intergenic
996276185 5:121668725-121668747 GTTTTTAAGGGGATCGTGGAGGG + Intergenic
996459076 5:123720381-123720403 TTTCTTCAGAGGATACTGGAGGG - Intergenic
996484212 5:124012404-124012426 GTGTTTCAGAGAATAGTGGATGG + Intergenic
996635852 5:125689422-125689444 AATTGTCAGAGGATGGTACAGGG + Intergenic
998848339 5:146332188-146332210 ATTTTACAGAGGCTGGTTAATGG + Intronic
999058016 5:148601959-148601981 ATTTTTCAGAAGCTGGGGGTTGG + Intronic
999456563 5:151721344-151721366 ATTTTTCAGAGGAGGAAGCATGG - Intergenic
999707620 5:154288070-154288092 TTCTTTGAGAGGAAGGTGGAGGG + Intronic
1000574374 5:162958449-162958471 CTTTGGCAGAGTATGGTGGAGGG + Intergenic
1001123136 5:168996370-168996392 CATTTTCAGTGGATGGGGGAAGG + Intronic
1002650697 5:180691038-180691060 ATTTTTCAGAGGATGAGGGTGGG - Intergenic
1003867405 6:10375884-10375906 ATTTTTCAAATTTTGGTGGAAGG + Intergenic
1004016854 6:11739450-11739472 ATTTTATGGAGGATGGTGGGGGG - Intronic
1005305716 6:24512394-24512416 ATTTTAGAGATCATGGTGGATGG - Intronic
1005425157 6:25695130-25695152 ATTTTTCAGAGCTTGGGGAATGG - Intronic
1006605767 6:35256746-35256768 ATTTTTAAGTGGATGATGGTAGG + Intergenic
1008824442 6:55676346-55676368 ATTTCTCATAAGATGGTAGAGGG - Intergenic
1009265557 6:61550533-61550555 ATTTTGCTGAGGTTGGGGGATGG + Intergenic
1009838310 6:69033372-69033394 ATTTTGCAGATGATAGTTGATGG - Intronic
1010420348 6:75666803-75666825 CTTTTCCAGTGGATGGTGCAGGG - Exonic
1010959010 6:82124102-82124124 ATGTTTTGGAGGATGGAGGAAGG + Intergenic
1011184660 6:84660961-84660983 ATTTTTGAGAGGAGGGTGGGAGG + Intergenic
1011344292 6:86352168-86352190 ATTTTACAGAAGCTGGTTGATGG + Intergenic
1011399309 6:86942590-86942612 ATTTTTTAGAGCATTGTGTAAGG - Intronic
1011492255 6:87904221-87904243 ACTTTTCAGAGGTTGGGGGAGGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1011988897 6:93487041-93487063 ATTTATCAGAGGCTAGTGGGTGG + Intergenic
1012350515 6:98244598-98244620 GATTTTCAGAGGCTGGGGGAAGG + Intergenic
1013023837 6:106249264-106249286 ATTTTTCAGGGGCTGGGGCAAGG - Intronic
1013059900 6:106623377-106623399 GTTTTTCAGAGGGTGGAGGGTGG + Intronic
1013513705 6:110866705-110866727 GTTTTTCAGAGGGTGGGGGAAGG + Intronic
1013651347 6:112198189-112198211 CTTTTTCAGTGGGTGGTGAAGGG + Intronic
1014903130 6:126993237-126993259 ATGTTTCAGAGGCTGTTAGATGG + Intergenic
1014946574 6:127505509-127505531 GTTTTTCAGAGGATGGAGCGTGG + Intronic
1015312005 6:131776495-131776517 ATCTTTCAGAGGGTGGAGGGTGG - Intergenic
1015474777 6:133648153-133648175 TTTTTTTAGAGGATGGGGTATGG - Intergenic
1017087764 6:150730300-150730322 ATTTTTCAAAGGATGAAGGGTGG + Intronic
1017696930 6:157025331-157025353 AGTTTTCTGAGCATTGTGGATGG + Intronic
1018045860 6:159965770-159965792 ATTTTTCCATGGATGGTGGAGGG - Intergenic
1018318663 6:162583839-162583861 AGGTTTCAGAGGATAGTGGTGGG - Intronic
1020472356 7:8553314-8553336 TTTTTTCTGAGGAAGGTGGTGGG + Intronic
1021525113 7:21578185-21578207 ATTTTACAGGGGATCATGGAGGG - Intronic
1021626981 7:22603206-22603228 ACTTTACACAGGATGGTGGCAGG - Intronic
1023207703 7:37768906-37768928 GTTTTTCAGAGGAGGATGAATGG + Intronic
1023481176 7:40636336-40636358 ATTTCTCAGAGTATGGAGGCTGG + Intronic
1024469731 7:49755052-49755074 ATTTAACAGAGGGTGGAGGAGGG + Intergenic
1026542528 7:71292865-71292887 AATTTCCAGAGGATGGGGGGAGG - Intronic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1027740689 7:82000336-82000358 AATTTTCAGAGGATGAGGCAGGG + Intronic
1027876146 7:83771462-83771484 ATTTTCCAAAGGATATTGGAAGG + Intergenic
1028856563 7:95599794-95599816 TTTTTCCAGAGGGTGGGGGATGG + Intergenic
1028972390 7:96873644-96873666 ATTTTTCAGTAAATGGAGGAAGG + Intergenic
1029812213 7:103060857-103060879 ATGTTTCAGAGGTTGGGGTAGGG - Intronic
1029854212 7:103497750-103497772 ACTTTTCTGAGGGTGTTGGATGG + Intronic
1030249293 7:107424330-107424352 GGTTTTCAGAGAAGGGTGGAAGG + Intronic
1030332701 7:108288953-108288975 ATTTTTCTGAGGGTGGGGTAGGG + Intronic
1030648607 7:112092356-112092378 ATATTTCACAGGATTGTTGAGGG - Intronic
1030820848 7:114088274-114088296 AGTTCTCAGAGGAGGATGGAGGG + Intronic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1031721625 7:125183601-125183623 AATTCTCAGGGCATGGTGGAGGG + Intergenic
1031906499 7:127465806-127465828 GGTTTTCAGGGGATGGTGGCTGG - Intergenic
1032307929 7:130754444-130754466 AATTTTCCCAGGATGCTGGAAGG - Intergenic
1032984103 7:137317755-137317777 CTTTTTCAGGGGGTGGGGGAAGG + Intronic
1033038358 7:137895912-137895934 ATTCTTCAGAGGCAGCTGGATGG - Intronic
1033118524 7:138647077-138647099 ATATTTAAGAGGATGATGGCCGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1033382007 7:140830637-140830659 ACTTCTCAGAGGTTGGTGGATGG - Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1034005361 7:147466369-147466391 TTTTTACACAGAATGGTGGAGGG + Intronic
1034830726 7:154305345-154305367 ATTTTGGGGAGGATGGGGGAGGG - Exonic
1035067310 7:156116350-156116372 CTATTCCAGAGGATGGTGAAAGG + Intergenic
1035616528 8:1006218-1006240 CTTTTTCAGGGGTTGGGGGATGG - Intergenic
1035992510 8:4508638-4508660 TTTTTTCAGAGGGTGGGGGTTGG - Intronic
1036205586 8:6803444-6803466 ATTTTCCATAGGATGTGGGATGG - Intergenic
1036650042 8:10636415-10636437 ATTTTACCGAGGATGGTGACTGG - Intronic
1041506714 8:58607260-58607282 CTTATTCAGGGAATGGTGGAAGG + Intronic
1041623031 8:59995495-59995517 ATTTTTCAGTAGTTTGTGGAAGG - Intergenic
1041625999 8:60027808-60027830 TTTTTTCAGTGGAAGATGGAGGG + Intergenic
1042813751 8:72855059-72855081 ATTTTTCAGAGGCAGGTGTGTGG - Intronic
1043060840 8:75500842-75500864 ATTTTTCAGAGGCAAGGGGAGGG + Intronic
1043067753 8:75597140-75597162 ATTTTTCAAAAAATTGTGGAAGG + Intergenic
1043145089 8:76643048-76643070 ATCTATCAGAGGATGGAGGGTGG - Intergenic
1045426977 8:102077123-102077145 CCTTTGCAGAGGCTGGTGGAGGG + Intronic
1045605157 8:103765246-103765268 ATTTTTCAGAAAAGGGTGAAGGG + Intronic
1046589239 8:116186215-116186237 ATTTTAGAGAGGCTGGTGGGAGG - Intergenic
1048265933 8:132985938-132985960 ATTTTGCAGGGGGTTGTGGAGGG + Intronic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1050568870 9:6916870-6916892 ATTTTTCTGTGCTTGGTGGATGG + Intronic
1051108780 9:13610985-13611007 ATTTTCCAGAGGCTGGTGGCTGG + Intergenic
1051355490 9:16236243-16236265 ATTTTGCAGAAGTTGTTGGATGG - Intronic
1051381097 9:16459429-16459451 ATTTTACTGAGGGTGGTGGGTGG + Intronic
1052268452 9:26601497-26601519 CTTCTTCAGAGCATGGTGGCTGG - Intergenic
1052282884 9:26753147-26753169 AGTTCTCAGAGAATGGTGAAGGG - Intergenic
1052509387 9:29395923-29395945 ATTTTCCAACTGATGGTGGATGG + Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1054858987 9:69930535-69930557 ATTTTGCTGAGAATGGTGTATGG + Intergenic
1055278515 9:74647189-74647211 ATTTTGCAGTGGTTGGTGGCAGG + Intronic
1055777851 9:79785191-79785213 ACCTTTAAGAGGATGGTGGCTGG + Intergenic
1055801006 9:80036146-80036168 ATTTTGCAATGGATGGTAGAGGG - Intergenic
1056292175 9:85154742-85154764 GGTTTTCAGAGGTTGGTGGAAGG + Intergenic
1057540443 9:95963527-95963549 ATTTTGGAGAGGAGTGTGGAGGG - Intronic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1057892609 9:98880751-98880773 AGTTTTCTTAGGATAGTGGAGGG - Intergenic
1058617315 9:106845159-106845181 ATTTTTTATAGGTTGGAGGATGG - Intergenic
1059372638 9:113855271-113855293 ATTTTTCAATGGATGATGGTGGG - Intergenic
1059442004 9:114313217-114313239 ATTTTCCAGGGGTTGGGGGAGGG - Intergenic
1060159675 9:121349687-121349709 ATTTTTCTGAGGGTGTTGGGTGG + Intronic
1060465524 9:123901381-123901403 ATTTTTAATAGGAGGGTAGAGGG - Intronic
1060764764 9:126286023-126286045 GCTTTTCAGACGATGGAGGATGG + Intergenic
1061787257 9:133037252-133037274 ATTTTGCTGAGGAGGGTGTAAGG + Intronic
1062052446 9:134454594-134454616 ATTTTACAGATGATGTGGGATGG - Intergenic
1062129699 9:134885768-134885790 GTTTTCCAGCGGAGGGTGGATGG + Exonic
1062144312 9:134980500-134980522 ATTCTTCACTGGAAGGTGGAAGG - Intergenic
1185895132 X:3851670-3851692 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185900250 X:3890095-3890117 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1185905366 X:3928526-3928548 ATTTATCAGAGGAGAGGGGATGG - Intergenic
1186169604 X:6862813-6862835 AATTTGCAAAGGATGGTGGATGG + Intergenic
1187030580 X:15484070-15484092 ACTGTTCTGAGGGTGGTGGATGG - Intronic
1187166470 X:16808945-16808967 ATTTTTCATAAGATGTTGGAGGG - Intronic
1187880568 X:23843343-23843365 ATTTGTGACAGGGTGGTGGATGG - Intronic
1189933674 X:46041741-46041763 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1191724965 X:64269695-64269717 ATTTTTCTGAAGGTGGTGGGGGG + Intronic
1192407523 X:70901485-70901507 ATTTTTCCACGGATGGTGGGGGG + Intronic
1192988299 X:76424217-76424239 ATCTTCCAGAGGCTGGTGGGAGG - Intergenic
1193667319 X:84337920-84337942 TTTTTTAAGGGGCTGGTGGAGGG - Intronic
1194251227 X:91577373-91577395 ATTTTTCTGGGCTTGGTGGAGGG - Intergenic
1194502065 X:94693501-94693523 ATTTTTCTGTGGTTGTTGGATGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1196231323 X:113226048-113226070 GCCTTTCAGAGGATGGAGGATGG - Intergenic
1196859200 X:120011676-120011698 ATTTTTCAGAGGATGAAGTCTGG - Intergenic
1197148054 X:123190444-123190466 ATTTTTCATAGGGCGGGGGAGGG + Intronic
1197267163 X:124386985-124387007 ATGTTTCAGAGGAAGGTAAATGG + Intronic
1198271297 X:135058766-135058788 ATTTTTCCAAGGATGGGGGTTGG - Intergenic
1198284028 X:135172052-135172074 ATTTTTCACAGGATGACGAAAGG + Intergenic
1198760020 X:140022562-140022584 ATTCTTCATAGCATGGTGGCTGG + Intergenic
1198920926 X:141725880-141725902 GTATTTCTGAGGATGGTAGATGG + Intergenic
1199619102 X:149683400-149683422 GTTTTTAAGAGGATCATGGAGGG + Intergenic
1199940531 X:152621934-152621956 ATTTTTCCAAGAATGGTTGAAGG + Intergenic
1200034947 X:153321014-153321036 ATGTTACAGATGATGGTGGGAGG - Intergenic
1200570169 Y:4818605-4818627 ATTTTTCTGGGCTTGGTGGAGGG - Intergenic
1202600774 Y:26591040-26591062 ATTGTTCAGAGGGTGGCAGAAGG - Intergenic