ID: 1124586057

View in Genome Browser
Species Human (GRCh38)
Location 15:31008532-31008554
Sequence TGGGATAAACTACCTGATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124586054_1124586057 -7 Left 1124586054 15:31008516-31008538 CCTAGCCTTTTATTCCTGGGATA 0: 1
1: 0
2: 8
3: 43
4: 224
Right 1124586057 15:31008532-31008554 TGGGATAAACTACCTGATCGTGG 0: 1
1: 0
2: 1
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124586057 Original CRISPR TGGGATAAACTACCTGATCG TGG Intronic
910165992 1:84328215-84328237 TGGGAGAAAGTGCCTGCTCGTGG - Intronic
917402944 1:174671645-174671667 TGGGATTAATTACTTGATTGTGG + Intronic
919753549 1:201053052-201053074 AGGGACAACCTCCCTGATCGTGG - Intronic
922096124 1:222444442-222444464 TGGGCTAAACTACATGCTTGGGG - Intergenic
924818479 1:247464050-247464072 TGGGAAAAAATACCTGATAAGGG - Intergenic
1063514945 10:6686731-6686753 GGGGATGAACTACCTGGTTGTGG + Intergenic
1064400265 10:15015135-15015157 TGGGATATACTATCTGACAGGGG - Intergenic
1079507696 11:21172458-21172480 TGGGATCAACTGCATGATCACGG - Intronic
1083619801 11:64043259-64043281 TGGGATAATCACCCTGCTCGGGG + Intronic
1115657743 14:35459903-35459925 TTGGATAAACTTCCTGAACTGGG + Intergenic
1116101347 14:40441163-40441185 TGGGAGAAACTGCCTGACTGAGG + Intergenic
1117306584 14:54482573-54482595 AGGGAAAAAGTGCCTGATCGGGG + Intronic
1124586057 15:31008532-31008554 TGGGATAAACTACCTGATCGTGG + Intronic
1126214299 15:46136547-46136569 TGAGAAAAACTACCTGAACATGG + Intergenic
925787554 2:7447847-7447869 TGGGACAAACTACCTGCCCAGGG + Intergenic
937139861 2:119590690-119590712 TGTGATAAACTACCTCAGCCAGG - Intronic
938409381 2:131051247-131051269 TGGGATCACCCACCTGATGGTGG - Exonic
938798914 2:134742079-134742101 TGGGATAAATTTCTTGATCATGG - Intergenic
939045535 2:137245552-137245574 TGGGATAATCTACTTAATGGAGG - Intronic
942699579 2:178689502-178689524 TGGGATTAAGTACCTGCTGGTGG + Exonic
944665259 2:201954164-201954186 TGGGACAAGCTTCCTGATCGAGG - Intergenic
947033580 2:225825260-225825282 TGGGAGAGACTTCCTGATAGGGG + Intergenic
949157966 3:850125-850147 TGGGATTTACTATCTGATAGGGG + Intergenic
952635468 3:35523884-35523906 TAGGATAAACTACCGGAAAGAGG - Intergenic
965904530 3:173687129-173687151 TAAGGTAAACAACCTGATCGTGG - Intronic
972168187 4:36312632-36312654 TGGGATAAACTCCCTGAGATAGG - Intronic
978471893 4:109077332-109077354 TGGGATAAACTATCAGCTTGTGG + Intronic
979889823 4:126077313-126077335 TGGGAGAAGCAACCTGATGGAGG + Intergenic
988361315 5:30239825-30239847 TGGGAGAAACCACCTGACTGTGG + Intergenic
988657800 5:33231403-33231425 TGGGTTAAAATACCTGACCCAGG - Intergenic
989318135 5:40105505-40105527 TGGGATAAATTACGTGCTCCAGG + Intergenic
1000569602 5:162895684-162895706 TGGGATAGACTGGCAGATCGGGG - Intergenic
1001589198 5:172853861-172853883 TGAGATAAACGAACTGATCATGG - Intronic
1005325755 6:24698965-24698987 TGAGTTAAACTACATGATCAGGG + Intronic
1012379508 6:98603355-98603377 CGAGATAAACTACCTAATTGTGG - Intergenic
1015301360 6:131656174-131656196 TTGGGTAAACTACCTGATCCTGG + Intronic
1018659442 6:166072539-166072561 AGAGATAAACTAACTGATTGAGG - Intergenic
1028669867 7:93388885-93388907 TGGAATAAACTCCCTGGTCATGG - Intergenic
1029693377 7:102197197-102197219 TGGAATAAACTGACTGTTCGTGG + Exonic
1044260917 8:90119594-90119616 TTGAATAAACTACCTGACCCTGG + Intergenic
1047890831 8:129306823-129306845 TGGGATAAAAGATCTGATCCAGG - Intergenic
1057933748 9:99219454-99219476 TGGGATAAATTACTTGATCGTGG - Intronic
1058216778 9:102243536-102243558 TTGCATAAACTGCCTGATTGAGG + Intergenic
1059293143 9:113245722-113245744 TGGGAGAATCGACCTGATCTTGG - Intronic
1061149336 9:128820125-128820147 TGGCACTAACAACCTGATCGTGG - Exonic
1198514512 X:137391380-137391402 TGGGATAACCTACTTGGTCATGG - Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198949713 X:142056822-142056844 TGGAATGTACTACCTGATTGTGG + Intergenic