ID: 1124590617

View in Genome Browser
Species Human (GRCh38)
Location 15:31050159-31050181
Sequence ATGACTCAGGGCCCCTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124590613_1124590617 -8 Left 1124590613 15:31050144-31050166 CCATTGCTGAACAGGATGACTCA 0: 1
1: 0
2: 2
3: 5
4: 131
Right 1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 141
1124590611_1124590617 4 Left 1124590611 15:31050132-31050154 CCAGGTACAGAACCATTGCTGAA 0: 1
1: 0
2: 6
3: 52
4: 371
Right 1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124590617 Original CRISPR ATGACTCAGGGCCCCTCTGT GGG Intronic
903009347 1:20319162-20319184 GTGACTCACTGCCCCTCTCTGGG - Intronic
904868709 1:33602755-33602777 ATCACTGCAGGCCCCTCTGTGGG + Intronic
904963082 1:34349928-34349950 ATCACTGAGGTCCCCTCTGGAGG - Intergenic
905018936 1:34795236-34795258 ACTTCTCAGGACCCCTCTGTTGG - Exonic
906152653 1:43596531-43596553 TTGAGTGAGGGCACCTCTGTTGG + Intronic
910847105 1:91614280-91614302 ATGACACAGAGCCCCTCAGTGGG - Intergenic
910869130 1:91815635-91815657 TTGACTTAGGGCCCCTCTCTTGG + Intronic
911117429 1:94260325-94260347 TTGAGGCAGGGCCCCTCTGGGGG - Intronic
911250849 1:95574886-95574908 ATGAATTAGGGTCCATCTGTTGG + Intergenic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
922422850 1:225471213-225471235 ATTGCTCAGAGCCCCACTGTGGG + Intergenic
923248258 1:232154811-232154833 ATTATTGAGGGCTCCTCTGTGGG + Intergenic
923899853 1:238313881-238313903 GCAACTCAGGGACCCTCTGTGGG + Intergenic
1066619740 10:37334026-37334048 ATGATTCAGGACCCCACTATTGG - Intronic
1067350370 10:45470319-45470341 AGGACTGAGGGCCCGTCTGCTGG + Intronic
1069908026 10:71743505-71743527 CTGACTCTGGGCACCCCTGTGGG + Intronic
1070449705 10:76545850-76545872 AGAAATAAGGGCCCCTCTGTAGG + Intronic
1070840167 10:79480411-79480433 GTGACTGAGGGCTCCTCTCTAGG - Intergenic
1072258772 10:93646890-93646912 ATGGCTCAGTGCCTCTCTGATGG - Intronic
1072761149 10:98058015-98058037 CTGACTCAGGGCACATCTTTGGG - Intergenic
1075624340 10:123950917-123950939 ATCACCCAAAGCCCCTCTGTGGG - Intergenic
1075661933 10:124203406-124203428 CTGACTCAGGGCCTCTCAGAAGG - Intergenic
1076616989 10:131761593-131761615 ATGAATCTGGGACCATCTGTGGG + Intergenic
1078081511 11:8207633-8207655 ATTAGTCAGGGCCCCCCTGTGGG + Intergenic
1079180688 11:18190645-18190667 ATTATGCAGGGCCCCTATGTGGG + Intronic
1080399700 11:31922425-31922447 ATGTCTCATGGCCCCTCCCTTGG + Intronic
1080623220 11:34004981-34005003 ATCCTTCAGGGCCTCTCTGTGGG - Intergenic
1080626171 11:34032684-34032706 CTGACTCAGTTCCCCACTGTTGG + Intergenic
1084273426 11:68040543-68040565 AGGGCCCAGGGCCCCTCTGTGGG - Intronic
1088222638 11:107586029-107586051 AGAACTCATGGCCCCTCTGGTGG - Intergenic
1089922091 11:122219061-122219083 AGAACTCAGGGCACCCCTGTAGG + Intergenic
1090245967 11:125216316-125216338 GTGACCCTGGGCCCCTCTCTGGG + Intronic
1094830055 12:34296032-34296054 AAGACTCAGGACCCCTTTCTCGG - Intergenic
1096518845 12:52172934-52172956 ATGACTGAGTGACCCTGTGTGGG - Intronic
1102049376 12:109851507-109851529 ATTATGCAGGGCCCCTATGTGGG - Exonic
1103140306 12:118542252-118542274 ATGACTCAGTCCCCCTCTTCTGG - Intergenic
1104349072 12:128029219-128029241 ATGACTCAGGGCCTGCCTCTGGG + Intergenic
1106259784 13:28056326-28056348 CTGACCCAGGGCACCTCTGTGGG + Intronic
1106721339 13:32437774-32437796 ATGACTAAGGTGCCCACTGTAGG - Intronic
1116483785 14:45422360-45422382 ATGCTTCAGGGGCCCTCTGTAGG - Intergenic
1118816619 14:69318646-69318668 AGGACTTACGGCCACTCTGTGGG - Intronic
1121617447 14:95322093-95322115 GTGTCTCTGGGCTCCTCTGTGGG + Intergenic
1121783954 14:96640561-96640583 ATGACTCTGGGCCCATGGGTAGG - Intergenic
1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG + Intronic
1124972978 15:34508211-34508233 GTGTCTGAGGGCCCCACTGTGGG - Intergenic
1125784195 15:42301146-42301168 ATGAGTCAGGGCACTTCAGTTGG - Intronic
1129785835 15:78309516-78309538 ATGACTCAGTCCCCCAGTGTGGG - Intergenic
1131094405 15:89646638-89646660 ATGACTCTGGGCCTCTCAGAAGG - Intronic
1131430004 15:92379458-92379480 AGGATTCAGTTCCCCTCTGTGGG + Intergenic
1132876845 16:2143747-2143769 GTGACTCAGTGCTCCTCTCTCGG + Intronic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1133591808 16:7251951-7251973 ATCACCCAGTGCCCCACTGTTGG - Intronic
1136450467 16:30351781-30351803 CTGACTCAGGGGCTCTCTCTCGG + Exonic
1137427565 16:48392401-48392423 ATGGCTCATGGCCCCTTTCTGGG - Intronic
1137715967 16:50598546-50598568 CTGGCTCAGGGCCACCCTGTCGG + Intronic
1141629850 16:85281424-85281446 ATTACTCATATCCCCTCTGTAGG + Intergenic
1142032614 16:87846070-87846092 GCGACTCAGGGCACCTCTTTTGG - Intronic
1142494918 17:301059-301081 AGGCCTCAGGCCCACTCTGTAGG + Intronic
1143870314 17:9953461-9953483 CTGACTCAGGCACCCTCTTTAGG + Intronic
1144579576 17:16450792-16450814 ATGACTCAGGGCCAGGCTATTGG + Intronic
1144947684 17:18978165-18978187 ATGGCTCAGGGTCCCCCTGGGGG + Exonic
1148165060 17:45477791-45477813 AGAACACAGGGCACCTCTGTTGG + Intronic
1148442057 17:47716541-47716563 ATGAGTCAGGGCCCTTCAGAGGG - Intergenic
1148478303 17:47943437-47943459 ATGGCTGTGGGCCCCTCTTTGGG + Intronic
1148955835 17:51352972-51352994 ATGTCTCAGAGCAGCTCTGTGGG + Intergenic
1149517756 17:57293237-57293259 GAGACTCAGGGCCCTACTGTTGG + Intronic
1150396290 17:64824516-64824538 AGAACACAGGGCACCTCTGTTGG + Intergenic
1150433924 17:65139568-65139590 ATGCCTCAGGGTCCGTCTGCTGG + Intronic
1151440195 17:74123629-74123651 ATGACTCCAGCCCCCACTGTTGG - Intergenic
1151516460 17:74599273-74599295 CTGACTCAGTGCTCCTCTCTAGG - Intergenic
1151546294 17:74795323-74795345 ATGACTCAGGAGCCCTTGGTGGG - Intronic
1151756988 17:76080660-76080682 TAGCCTCAGGGCCCCTCTCTAGG + Intronic
1152112737 17:78366071-78366093 ACTTCCCAGGGCCCCTCTGTGGG - Intergenic
1152611137 17:81315491-81315513 AACCCTCAGGGACCCTCTGTCGG - Intronic
1152625794 17:81387395-81387417 ATGTCACCGGGCCCCACTGTGGG + Intergenic
1152711616 17:81873312-81873334 AAGACTCAGAGCCCCTGTGCAGG + Intergenic
1153813088 18:8769183-8769205 ATGCCCAAGGGCCCATCTGTAGG + Intronic
1153957802 18:10112974-10112996 ATCATTCAGGAACCCTCTGTAGG - Intergenic
1154026256 18:10710018-10710040 ATGAATCAGTGCCCCTTTCTGGG + Intronic
1159607426 18:70489653-70489675 ATCATTCTGGGCTCCTCTGTAGG - Intergenic
1160400067 18:78603716-78603738 GTGGCTTCGGGCCCCTCTGTAGG - Intergenic
1160686340 19:438662-438684 AGGACTCCTGGCCCCTCTGGGGG + Intronic
1161699660 19:5787777-5787799 CTGGCTCAGGGCCCCCCAGTGGG - Intronic
1162317001 19:9945638-9945660 ATGACTCAGGAGGCCTCTCTGGG + Intergenic
1165093133 19:33396916-33396938 CTGACTCAGGGCCACCCTGCCGG + Intronic
1166380313 19:42352222-42352244 ACTTCTCAGGGCCCCTCGGTGGG + Exonic
1167124787 19:47542028-47542050 ATGACTGAGTGATCCTCTGTTGG - Intronic
925875010 2:8303974-8303996 AGGACACAGGGCTCCTCTCTGGG - Intergenic
929670220 2:43871557-43871579 AGGACTCAGTGCCCCTCCATGGG - Intronic
931213914 2:60224027-60224049 ATAACTCTGGCCCCCTCTGGGGG + Intergenic
934777811 2:96950150-96950172 GTGACGCAGGGCCCCTCTGTGGG + Intronic
937861576 2:126715376-126715398 CTGACTCAGGGCCCTTCAGTGGG + Intergenic
938412129 2:131074012-131074034 ATGCCTGAGGCCCCCTCTGTTGG - Intronic
938604099 2:132874426-132874448 ATGACGTAGGGCCCAGCTGTAGG + Intronic
944656626 2:201882130-201882152 ATGCACCACGGCCCCTCTGTTGG - Intronic
946762047 2:223004333-223004355 GTGACTGGGGGCTCCTCTGTGGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
947767036 2:232644412-232644434 GTGGCTAAGGGCACCTCTGTTGG + Intronic
1170375960 20:15700137-15700159 AGGACTCACAGACCCTCTGTAGG - Intronic
1170464191 20:16608074-16608096 ATGACTTAGGTCTCCTCTGAGGG + Intergenic
1172034050 20:31999532-31999554 CTGACCCAGGCCCACTCTGTTGG + Exonic
1174513146 20:51071116-51071138 ATGAAACAGGGCTCCTTTGTGGG + Intergenic
1175363696 20:58435498-58435520 ATGACTCGGGGCTCCCCTTTGGG - Intronic
1175605373 20:60308288-60308310 ATGACACAGAGCCCCTCTGCTGG + Intergenic
1175713160 20:61237163-61237185 AGGACACAGGCCCCCTATGTTGG - Intergenic
1175793740 20:61758335-61758357 ATTACTCAGTGCTCCACTGTGGG + Intronic
1178475779 21:32935858-32935880 CTGACTCAGGGTCCCTCTTGAGG + Intergenic
1179158175 21:38869318-38869340 GTGACTTGGGGCCCCTCAGTTGG + Intergenic
1180181125 21:46119137-46119159 CTGCCTCAGGGCCCCGCTCTGGG + Intronic
1183346934 22:37313157-37313179 ATGTCTCTGGGCCCCTCTCCAGG - Intronic
1184404288 22:44291494-44291516 ATGAGTCAGGCCCCTTGTGTTGG + Intronic
1184502676 22:44883250-44883272 ATGACTGGGTGCCCCTCTGGCGG + Exonic
1185071501 22:48659194-48659216 ATGATTCTGGGTCCCTTTGTGGG - Intronic
1185402218 22:50625130-50625152 ATGCCTGAGGGCCCCTCGGCTGG - Exonic
950500231 3:13359027-13359049 ATGGCTCAGGGCCCATCTTGAGG + Intronic
950505050 3:13389357-13389379 TCCACTCAGGGCCCCTCTCTGGG - Intronic
953344702 3:42165615-42165637 AGGACTCAGGCCCCTTCTCTGGG - Intronic
953813376 3:46133243-46133265 AAGACTCAGGACACCTCTGATGG + Intergenic
962628000 3:137246404-137246426 ATGACTCAGGGTCCTTCACTTGG - Intergenic
964608821 3:158588247-158588269 CTGACTCAGGGCCTCTCTGTAGG - Intronic
968287140 3:197515425-197515447 AAGACTCAGGGCGCGTCTGCAGG - Intronic
983317412 4:166149689-166149711 TGGCCACAGGGCCCCTCTGTTGG + Intergenic
992565549 5:77992255-77992277 ATGACCCAGGACCCCTATATTGG - Intergenic
997926570 5:138035706-138035728 ATGACTATGGTCCCCTCTTTAGG - Intronic
998337626 5:141387619-141387641 CTGACTCTGGGCGCCGCTGTTGG + Intronic
998338734 5:141397865-141397887 CTGACTCTGGGCGCCGCTGTTGG + Intronic
1000953395 5:167513223-167513245 ATGACCCAGGGACCTTCTGAGGG + Intronic
1003002246 6:2347096-2347118 AAGACACAGGGGGCCTCTGTGGG - Intergenic
1004785503 6:18963644-18963666 ATGTCGCAGGGTGCCTCTGTAGG - Intergenic
1007287906 6:40761432-40761454 GAGACTCAGGACCCCTCTGATGG - Intergenic
1011675545 6:89729801-89729823 AGGACTCAGTGCTCCTGTGTAGG - Intronic
1011697007 6:89921884-89921906 ATGACTCAGGACCACTCGGAGGG - Intergenic
1018904948 6:168070495-168070517 AAGACTGAGGTCCCCTCTGGAGG + Intronic
1019017074 6:168887861-168887883 GTGCCTCTGGGCCCCTCCGTAGG + Intergenic
1021048086 7:15948084-15948106 ATGACACAGGGCACCTATGATGG - Intergenic
1028649814 7:93138857-93138879 GTGAGGCAGGGCCCCTCTGTCGG - Intronic
1031134512 7:117871986-117872008 GTGAATCAGCTCCCCTCTGTGGG - Intronic
1035484910 7:159215294-159215316 GGGACTCAGGGGCCCTCTGTGGG + Intergenic
1040388770 8:46932556-46932578 ATGTCTCAGGATCTCTCTGTGGG - Intergenic
1043014740 8:74923767-74923789 TTCACTCATGGCCCCACTGTTGG - Intergenic
1044772409 8:95650513-95650535 TTGTCTCAGGGCCTCTTTGTGGG - Intergenic
1049154893 8:141060389-141060411 CTGGGTCAGGGCCCCTTTGTAGG - Intergenic
1050667049 9:7950689-7950711 ATGACTCACAGCCACTCTGGTGG - Intergenic
1056830978 9:89917210-89917232 TTGACTCAGAGCCTCTCTCTAGG + Intergenic
1058531350 9:105908257-105908279 ATGACTCAGGCGCCATCAGTGGG + Intergenic
1060266760 9:122116133-122116155 TTGACTCAGGGCCTCTGTGTGGG - Intergenic
1060952967 9:127616546-127616568 GTGGCTCAGGGCCCCTCAGGAGG + Intronic
1061382617 9:130267318-130267340 ATGACTCAGAGGCTCTCGGTGGG - Intergenic
1061508912 9:131048780-131048802 ATGTCCCAGGGCCCCCATGTGGG + Intronic
1061600340 9:131665598-131665620 ATCACACAGGGCCTCTCTGAGGG - Intronic
1189124819 X:38435360-38435382 ATGACGCAGGACTCCTCTGATGG + Intronic
1192168358 X:68839897-68839919 ATGACTGAGGGCACCTATGCTGG + Intronic
1195195489 X:102493962-102493984 ATTTCTTAGAGCCCCTCTGTTGG - Intergenic
1195908029 X:109864737-109864759 TTGCTTCATGGCCCCTCTGTGGG + Intergenic
1200054924 X:153455347-153455369 AGGGCTCTGGGCCCCTCAGTGGG - Intronic
1200169056 X:154058824-154058846 AGGACCCAGGGCCCCTCAGTGGG - Intronic
1201247385 Y:12018737-12018759 ATGACTCAGGCCCTCCCTCTGGG + Intergenic