ID: 1124592075

View in Genome Browser
Species Human (GRCh38)
Location 15:31062378-31062400
Sequence ACCAGGGGCCCTCCCCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1124592068_1124592075 28 Left 1124592068 15:31062327-31062349 CCTCAGAGGGTGTTGTGTGGTGT 0: 1
1: 0
2: 2
3: 12
4: 190
Right 1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 241
1124592069_1124592075 1 Left 1124592069 15:31062354-31062376 CCCCACTTGCTAAAGTTTGAAAG 0: 1
1: 0
2: 2
3: 22
4: 171
Right 1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 241
1124592070_1124592075 0 Left 1124592070 15:31062355-31062377 CCCACTTGCTAAAGTTTGAAAGC 0: 1
1: 0
2: 0
3: 18
4: 191
Right 1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 241
1124592071_1124592075 -1 Left 1124592071 15:31062356-31062378 CCACTTGCTAAAGTTTGAAAGCA 0: 1
1: 0
2: 4
3: 21
4: 218
Right 1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG 0: 1
1: 0
2: 1
3: 13
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1124592075 Original CRISPR ACCAGGGGCCCTCCCCTGTG TGG Intronic
900168146 1:1252926-1252948 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
900206030 1:1432258-1432280 AGCAGGGCCCCTTCCTTGTGTGG - Intergenic
900358249 1:2275047-2275069 ACCTGGTGCCACCCCCTGTGAGG - Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
900619687 1:3581046-3581068 ACCAGGGGCTGTGCCCGGTGGGG + Intronic
900707386 1:4089175-4089197 AGCAGGGACCCTCCCCAGGGTGG - Intergenic
901351861 1:8604485-8604507 ACCAGCCGACCTCCTCTGTGTGG - Intronic
901377171 1:8847793-8847815 CCCAGGGCCCCTGCCTTGTGTGG + Intergenic
902618739 1:17638340-17638362 ACCTGGAGCCCTCCTCTGAGAGG - Intronic
903262159 1:22137158-22137180 ACCAGGTCCCCTCCTCTGCGGGG + Intronic
903926755 1:26835909-26835931 CCCAGGGCTCCTGCCCTGTGGGG + Intronic
905012111 1:34754886-34754908 ACCTGTGGCTCTCCCCTGAGAGG + Intronic
905308329 1:37033846-37033868 ACCAGGAGCTCCTCCCTGTGAGG - Intronic
905709023 1:40085288-40085310 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
916463500 1:165049591-165049613 TCCAGGGCCCCTGCCCTGGGTGG + Intergenic
920577459 1:207072058-207072080 GCCATGGGCCATGCCCTGTGAGG + Intronic
921836008 1:219779505-219779527 ACCAGGCCCCCTCTCCTGTCTGG - Intronic
923604670 1:235432423-235432445 CCTAGGGCCCCTCCTCTGTGAGG + Intronic
924577485 1:245293497-245293519 ACCAGGAGCCATCTGCTGTGAGG - Intronic
1067472995 10:46549597-46549619 AGGAGGTGCCGTCCCCTGTGCGG - Exonic
1069832486 10:71289754-71289776 ACCAGGAGCCCAGCCCTGAGGGG + Intronic
1071430132 10:85600874-85600896 AGCAGGGGCCCTCCCCACTCAGG - Exonic
1072082509 10:92045832-92045854 CCCAGGGGCCCTGGCCTGGGCGG - Intergenic
1073045849 10:100637811-100637833 ACCAGAGGCCCTGCCCAGAGTGG + Intergenic
1076148177 10:128141655-128141677 ACAAGGGGTCCCTCCCTGTGTGG - Intergenic
1076329870 10:129656329-129656351 ACCAGGAGCCCTCCCATGCTCGG - Intronic
1076862319 10:133144310-133144332 ACATGGGGCCCTTCCCTGTTAGG - Intergenic
1076912324 10:133397260-133397282 ACAAGGGGCCCTTCCCTGCCTGG - Intronic
1077706625 11:4493002-4493024 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1078088104 11:8246864-8246886 ACCAGGGCCTGCCCCCTGTGAGG - Intronic
1079025116 11:16940964-16940986 ACCAGGTGCCCTCCACTCTCTGG + Intronic
1079629544 11:22657254-22657276 CCCAGGGCCCAACCCCTGTGTGG - Intronic
1080605574 11:33862200-33862222 TCCAGGGTCCCTCCCCTCTGAGG - Intronic
1082954170 11:58851034-58851056 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1084044763 11:66562172-66562194 AGCAGGGGCCTGGCCCTGTGGGG + Intronic
1084172623 11:67407891-67407913 GCCAGTGGTCCTCCGCTGTGCGG - Intronic
1089662211 11:119993005-119993027 TCAAGGCTCCCTCCCCTGTGTGG - Intergenic
1090799033 11:130159538-130159560 TCCAGGGGCCCTGCCCCGGGAGG - Intergenic
1091299551 11:134498670-134498692 ACCAGGAGCCCTACCCCATGGGG - Intergenic
1091681119 12:2527771-2527793 AGCAGATGCTCTCCCCTGTGGGG - Intronic
1091801310 12:3326406-3326428 TCCAGGTTCCCTCCCCTGGGAGG + Intergenic
1092177835 12:6423017-6423039 ACCAGTGGCCCTCCCTTAGGGGG + Intergenic
1092281651 12:7102016-7102038 ACCAGGGGGCCTGCCCAGAGGGG + Exonic
1092784901 12:12018007-12018029 ACCAGGGTCCCTCCACTGTGAGG - Intergenic
1096259510 12:50082002-50082024 ACCAAAGGCCCTTCCCAGTGAGG + Exonic
1103261478 12:119593087-119593109 TCCAGGTGCCCTCCCCAGTGTGG - Intergenic
1103446713 12:120999620-120999642 GCCAGGGCCTCTCACCTGTGGGG - Exonic
1104871468 12:132001315-132001337 ACAGGGGGCCCTCCCCTGCCTGG + Intronic
1104969459 12:132524620-132524642 ACCAGGGGCCCTGGCATGCGAGG + Intronic
1105020182 12:132811032-132811054 ACAGGGGGCCCTCCCCTGCCTGG - Intronic
1105041439 12:132964507-132964529 ACAAGGGGCCCTTCCCTGCCTGG - Intergenic
1105750540 13:23419163-23419185 ACCAGGGGCCCGTCCCTCTGGGG + Intronic
1109314880 13:60738833-60738855 ACAAGTGGCCCTCCCCAGTGTGG + Intergenic
1112760434 13:102688770-102688792 TCCTGGTGCCCTGCCCTGTGAGG + Intronic
1113329777 13:109316887-109316909 ACATGTGGCCCTCCCCAGTGTGG - Intergenic
1113362602 13:109645137-109645159 ACCAGGGGCCCTTCCCCGGCTGG + Intergenic
1113363045 13:109649119-109649141 AGGGGGGGCCCTCCCCAGTGTGG - Intergenic
1113413319 13:110109085-110109107 GCCAGGAGCCTTCCCCTGGGTGG - Intergenic
1113577280 13:111403487-111403509 AGCCGGGGTCCTCCCCTCTGCGG + Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1115821306 14:37215163-37215185 ACAGGGGGCCCTTCCCTGTTGGG - Intronic
1118805931 14:69236952-69236974 ATCAGGGCCCCTGCACTGTGAGG + Intronic
1121328387 14:93034813-93034835 CCCAGGGGCTATGCCCTGTGTGG + Intronic
1122921590 14:104882572-104882594 CCCAGGGCCCCGCCTCTGTGGGG - Intronic
1122936051 14:104956767-104956789 ACCAGGAGCCCTCCCTTCAGAGG + Intronic
1124005231 15:25790484-25790506 GCCAGAGGCCCTGCCCTCTGGGG - Intronic
1124592075 15:31062378-31062400 ACCAGGGGCCCTCCCCTGTGTGG + Intronic
1125717664 15:41828221-41828243 CCCAGGGCCCCTCCCGTGTTCGG - Intronic
1126061193 15:44784450-44784472 ACAGGGGGCCCTTCCCTGTTAGG + Intergenic
1126101749 15:45122080-45122102 AGCAAGGGCCCACCGCTGTGGGG + Intronic
1129892645 15:79081730-79081752 AGCAGGGGCCCTCCCTGGAGGGG - Intronic
1130049348 15:80470419-80470441 ACCAGGGTACCTGCTCTGTGAGG - Exonic
1130118851 15:81029336-81029358 ACCAGGGAACCTCCCCAATGAGG + Intronic
1130137026 15:81190037-81190059 GCCAGGGGCCCTGGCCTGCGTGG - Intronic
1132710374 16:1263639-1263661 GCCAGGGGCCCTCTGCAGTGGGG - Intergenic
1134240275 16:12500901-12500923 AACAGGTGCCCTCCACTGAGGGG - Intronic
1134400504 16:13905424-13905446 ACAAGGGGCCCTTCCCTGCCTGG - Intergenic
1135135329 16:19882933-19882955 AAGAGGGGCCCTCCGCTGGGAGG - Intronic
1136408541 16:30063846-30063868 CCCAGGGCCCCTGCCCTCTGGGG + Exonic
1136778046 16:32882029-32882051 GCCAGGGGCCCTCAACTGGGAGG - Intergenic
1136892575 16:33979485-33979507 GCCAGGGGCCCTCAACTGGGAGG + Intergenic
1138556811 16:57775669-57775691 ACTCGGGACCCTCCCCTGTTGGG - Intronic
1138926113 16:61593258-61593280 ACCAGGGTCACATCCCTGTGGGG - Intergenic
1139449221 16:67016756-67016778 ACCAGGGGCCATCCTGTGAGTGG - Intergenic
1141698409 16:85631477-85631499 ACCATGTGCCCTCCCCATTGTGG + Intronic
1141828902 16:86498646-86498668 ACCCGGGGCCCGCCCCCTTGGGG - Intergenic
1142247644 16:88977161-88977183 ATCTGGGGCCCTGCCCTGCGCGG + Exonic
1142364161 16:89640996-89641018 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1203080465 16_KI270728v1_random:1144138-1144160 GCCAGGGGCCCTCAACTGGGAGG - Intergenic
1142546605 17:708316-708338 ACAGGGGGCCCTTCCCTTTGTGG + Intronic
1142591895 17:1009908-1009930 ACACCAGGCCCTCCCCTGTGGGG - Intronic
1144994594 17:19258766-19258788 ACCAGAGACCTTTCCCTGTGTGG - Intronic
1145011390 17:19370336-19370358 GCCAGGGGCCATCTCCTCTGAGG - Intronic
1145746739 17:27325536-27325558 GCCCTGGGCCCTCCCCTGTCTGG + Intergenic
1146186732 17:30729105-30729127 ACCAGGTGTCCTGCCCTGTGGGG + Intergenic
1146653651 17:34622587-34622609 GCCAGGAGCCCTCCCCTCAGTGG + Intronic
1146761274 17:35481530-35481552 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1147835104 17:43324427-43324449 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1148751110 17:49946412-49946434 ACCAGGGGCACCCTCCTGTCAGG + Intergenic
1150700514 17:67443144-67443166 ACCAGGGCGCCTGCCCTGTCTGG + Intronic
1150858355 17:68774834-68774856 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1151480601 17:74368333-74368355 ACCAGAGGACCTGCCCTGAGCGG + Intronic
1151679175 17:75614765-75614787 ACCTCTGGACCTCCCCTGTGGGG - Intergenic
1151731596 17:75914708-75914730 ACCCTGGGCCCTCCACTGTCCGG + Intronic
1151898911 17:76998759-76998781 ACCAGGGACCCTGCCCTGTCAGG - Intergenic
1152328178 17:79654714-79654736 AAAAGGGGCCCTCCCCTGCAAGG - Intergenic
1152890865 17:82880980-82881002 CCCTGAGGCCCTGCCCTGTGTGG - Intronic
1153163071 18:2230462-2230484 ACAAGGGGCCCTTCCCTGCCTGG + Intergenic
1155178777 18:23325007-23325029 ACCAGGGGCAATCCTCTGTATGG + Intronic
1158385138 18:56980870-56980892 ACCAGAGGCCCTCGCCAGTCAGG + Intronic
1158680653 18:59563554-59563576 AGCAGGGGCCTTGCCCTGTAGGG - Intronic
1160234629 18:77076343-77076365 CCCAGGTGGACTCCCCTGTGGGG - Intronic
1161112895 19:2479540-2479562 CCCAGGTGCCCTCCCCTCTTGGG - Intergenic
1161142695 19:2657931-2657953 ACATGGGGCCCTTCCCTGTTTGG - Intronic
1161179752 19:2871933-2871955 ACAGGGGGCCCTTCCCTGCGTGG + Intronic
1161514646 19:4689789-4689811 ACATGGGGCCCACTCCTGTGGGG - Intronic
1161667545 19:5586287-5586309 TCCAGGGGCCGGCCACTGTGAGG - Intergenic
1161834055 19:6632991-6633013 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1162089453 19:8269446-8269468 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1162224196 19:9206087-9206109 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1162236346 19:9312649-9312671 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1162972168 19:14187387-14187409 ACCAGGTGTCCTGCCCTGTGGGG - Intronic
1163992146 19:21008633-21008655 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1164509552 19:28886143-28886165 ACCTGGGGCTCTCCCCACTGTGG + Intergenic
1164783456 19:30911773-30911795 AGCAGGGAGCCTCCCCTGTCTGG - Intergenic
1165081569 19:33310024-33310046 AGCGGGCGCCCTCTCCTGTGAGG + Intergenic
1165276927 19:34761504-34761526 AGCAGGGGCCTTACCCTATGAGG + Intronic
1165541175 19:36492880-36492902 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
1166140758 19:40803948-40803970 TCCTGAGGCCTTCCCCTGTGAGG + Intronic
1166404685 19:42511512-42511534 ACCACGTGCCCTCCCCTGGCAGG - Intronic
1167392861 19:49208024-49208046 GACAGGGGCCCTTCCCTGTTAGG + Intronic
1167471340 19:49677773-49677795 ACCTGGGGCCCTCCACGATGTGG + Intronic
927001044 2:18794357-18794379 TCCATGGCCCCTCCACTGTGTGG + Intergenic
927845958 2:26473069-26473091 ACCTGGAGCCCTTCCCTGGGGGG + Intronic
928215657 2:29359390-29359412 GCCAGGAACCCTCCTCTGTGTGG - Intronic
935894037 2:107714475-107714497 ACCAGGGGCCCCATCCTGTGAGG - Intergenic
940851204 2:158689822-158689844 AAGAGAGGCCCTCCCCTGTACGG + Intergenic
942596261 2:177594221-177594243 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
943084459 2:183295602-183295624 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
943351924 2:186806160-186806182 TCAAGAGGCCCTGCCCTGTGAGG + Intergenic
946245269 2:218383856-218383878 ACCACGGGGCCTCCTCTCTGTGG - Intronic
947145417 2:227059562-227059584 AAAAGGGGTCCTCCCCTGTTGGG - Exonic
948789779 2:240371285-240371307 CCCAGAGGCCCTCCCTGGTGTGG - Intergenic
948916001 2:241035357-241035379 ACCACGTGCCCACCCCTGGGAGG - Intronic
1169118950 20:3084094-3084116 ACCAGTGGCCATCTTCTGTGTGG + Intronic
1172785574 20:37466242-37466264 CCCAGTGGAGCTCCCCTGTGGGG + Intergenic
1172908273 20:38385888-38385910 AGCGAGGGCCCTCCACTGTGTGG + Intergenic
1174384122 20:50176574-50176596 ACCAGGGGCCTTCACCTCTGTGG + Intergenic
1176007464 20:62874254-62874276 ACAGGGGGCCCTCCCCTGCCTGG - Intergenic
1176115736 20:63431134-63431156 ACCCTGGGCCCTCCCCTGCCTGG - Intronic
1176382031 21:6118430-6118452 CCCAGGCTCCCTCCCCTGTCAGG + Intronic
1176410736 21:6448239-6448261 ACAAAGGGCCCTACCCAGTGTGG + Intergenic
1178155578 21:29849923-29849945 AACAGGGGCCATCCACTGTTGGG - Intronic
1179230560 21:39500271-39500293 CCCAGGAGCCCTGCCCAGTGGGG + Intronic
1179254406 21:39702731-39702753 ACTAGGGTGCCTCCCCTCTGTGG + Intergenic
1179686230 21:43056561-43056583 ACAAAGGGCCCTACCCAGTGTGG + Intronic
1179741441 21:43419809-43419831 CCCAGGCTCCCTCCCCTGTCAGG - Intronic
1180112028 21:45663195-45663217 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1182424382 22:30264389-30264411 CCCCGGGGCCTTCCCCAGTGAGG - Exonic
1182435783 22:30328822-30328844 ACCAGGAGCCCACCACTGTCTGG - Intergenic
1182467260 22:30525255-30525277 ACCAAGGGCCCTCACCTGGTAGG + Intronic
1182767857 22:32771598-32771620 TCCTGTGACCCTCCCCTGTGAGG - Intronic
1183095069 22:35547073-35547095 ACCAGTGGGCCTCACCTGTGAGG - Exonic
1184034329 22:41911275-41911297 ACCCTGGGCCCACCCCTGGGTGG - Exonic
1184133695 22:42533481-42533503 ACAGGGGGCCCTTCCCTGTTAGG - Intergenic
1184278878 22:43426115-43426137 ACCAGGGGCCCAGGCCCGTGAGG + Intronic
1184459400 22:44628503-44628525 ACCAGTGGGCCTGCCCTGGGAGG - Intergenic
1184837334 22:47031726-47031748 ACCCCGGCCCCTCACCTGTGAGG - Intronic
1185328770 22:50241684-50241706 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
950184389 3:10936369-10936391 ACCAGTTGCACTCCACTGTGTGG + Intronic
950415772 3:12868444-12868466 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
950576062 3:13832780-13832802 TCCAGGGGCCCTGTCCTATGGGG - Intronic
952921131 3:38284459-38284481 ACCAGGGGCCCTTGCCTGGCTGG - Intronic
954436882 3:50500994-50501016 ATCAGGGGCCTTCCCCACTGAGG + Intronic
956622896 3:71238807-71238829 TCCCGGGTCCCTCCCTTGTGTGG - Intronic
957593109 3:82225691-82225713 GCCAGGAGCCCTGCCCAGTGAGG + Intergenic
961614587 3:128168733-128168755 ACCAGAGGGCCTCCCCTCTTAGG - Intronic
962479858 3:135788747-135788769 ACCAGGTTCCCTCCCCTTGGAGG + Intergenic
964837236 3:160952599-160952621 ATCAGTGGCCCTCTCCTGTGAGG - Intronic
968108588 3:196022656-196022678 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
968404704 4:329839-329861 ACAGGGGGCCCTTCCCTGTTAGG + Intergenic
968559110 4:1267706-1267728 ACAGGGGGCCCTTCCCTGTTAGG + Intergenic
968680228 4:1913622-1913644 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
969480391 4:7443861-7443883 AACAGGGGTCCTCCCCAATGTGG + Intronic
972355493 4:38276463-38276485 ACCAGGTGCCCTCAGCTCTGAGG - Intergenic
975377791 4:73665720-73665742 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
975378428 4:73671129-73671151 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
981777467 4:148386281-148386303 AACAGGGCCACTCCCTTGTGTGG + Intronic
985291331 4:188391121-188391143 ACAGGGGGCCCTTCCCTGTTTGG + Intergenic
985553840 5:546578-546600 ACCAGCTGCCCTGCCCTATGAGG + Intergenic
985663273 5:1168059-1168081 GCCGGGGGCCCTGTCCTGTGGGG - Intergenic
985935896 5:3097752-3097774 CCCTGGAGCCCTCACCTGTGAGG - Intergenic
986081412 5:4398633-4398655 ACCATGGCCCCTACCCTGGGGGG - Intergenic
986986115 5:13502636-13502658 ACCAGGATCCCTCCCTTCTGTGG + Intergenic
992608301 5:78484399-78484421 ACCAGGGTCCATTCTCTGTGTGG + Intergenic
992828070 5:80569447-80569469 ACCGGCTGCCCGCCCCTGTGTGG + Intronic
998539298 5:142965033-142965055 ACAAGGGGCCCTTCCCTGCCTGG + Intronic
1000048442 5:157541121-157541143 ACCATGTGCCCTCCTCTCTGTGG - Intronic
1001802123 5:174553533-174553555 TCCTGGGGTCCTCCCCTGAGTGG - Intergenic
1002550810 5:179990281-179990303 ACAGGGGGCCCTTCCCTGTTAGG + Intronic
1002586305 5:180250902-180250924 ACCAGGGACGCTCCGCTGTGAGG + Intronic
1002606986 5:180389400-180389422 ACCATGGGCCCTTCTCTGAGAGG + Intergenic
1003096699 6:3147988-3148010 GGCAGAGGCCCTCCCCAGTGTGG - Intronic
1004672984 6:17815100-17815122 ACAAGGGTCCCTTCCCTGTTTGG + Intronic
1005922179 6:30411969-30411991 ACAGGGGGCCCTTCCCTGTTCGG - Intergenic
1006441390 6:34055847-34055869 ATCACTGCCCCTCCCCTGTGCGG + Intronic
1006931591 6:37692222-37692244 CCTACGGGCCCTGCCCTGTGCGG - Intronic
1007952491 6:45884773-45884795 ACCATGTGGCCTCCCATGTGGGG + Intergenic
1013470302 6:110458179-110458201 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1013556756 6:111264196-111264218 CACAGGGGCCCTTCCCTGTTTGG - Intronic
1015748575 6:136537298-136537320 ACCTAGGGCTCTTCCCTGTGAGG + Intronic
1018717382 6:166543987-166544009 ACCAGTTCCCCTGCCCTGTGAGG + Intronic
1018840172 6:167510766-167510788 ACCAGGGCCCCTCCCCTCCTTGG + Intergenic
1021514324 7:21466167-21466189 ACCAGAAGCCCTCACCTGTAGGG - Intronic
1021983493 7:26077460-26077482 ACAAGGTGCCTTCCCCTGTTAGG - Intergenic
1022660836 7:32365080-32365102 ACCAGGGGCTTTTCACTGTGGGG - Intergenic
1024174050 7:46820050-46820072 ACAAGGGGCCCTTCCCTTTTAGG + Intergenic
1030952452 7:115808208-115808230 ACCAGTGGTTCTCACCTGTGTGG - Intergenic
1034001988 7:147424531-147424553 ACCTGGGGCTCTCCACTGTTTGG - Intronic
1034210687 7:149359487-149359509 ACCAGGGTCCCTGAGCTGTGGGG - Intergenic
1035228263 7:157445434-157445456 ACCGGGAGCCCAGCCCTGTGGGG + Intergenic
1035324402 7:158055682-158055704 ACAGGGGGCCCTTCCCTGTTTGG - Intronic
1036693924 8:10962391-10962413 ACCAGGGGACCTCCCTCTTGGGG - Intronic
1037797219 8:22006019-22006041 ACCAGAGGCCCTGCTGTGTGTGG + Exonic
1038227498 8:25670540-25670562 ACCTGGGGCCAGCCCCCGTGCGG - Intergenic
1038947567 8:32378057-32378079 ACAAGCGGCCCTCCTCTGGGTGG - Intronic
1045548259 8:103147717-103147739 CCCAGGAGCCCTCCCATGTCAGG + Intronic
1046638917 8:116703636-116703658 GACAGGGGCCCTTCCCTGTTTGG - Intronic
1048274332 8:133054798-133054820 GCCTGGGTCCCTCCCCTTTGTGG - Intronic
1049056945 8:140244211-140244233 ACCAGGGGCCCTGCCTGCTGCGG - Intronic
1049494071 8:142921559-142921581 CGCAGGGGCCCTTCCCTGTGAGG + Intergenic
1049561701 8:143315381-143315403 ACACGGGGCCCTTCCCTGTTTGG - Intronic
1049655087 8:143793737-143793759 ACCATGGGGCCTCCTGTGTGAGG - Intronic
1055965197 9:81859300-81859322 ACCAAGGGCCCTCCCTTGGAAGG + Intergenic
1057144611 9:92749491-92749513 CCCATGGCCCCTCCTCTGTGAGG + Intronic
1057281015 9:93711566-93711588 AACAGGTGGCCTCCCCAGTGTGG + Intergenic
1057336585 9:94160376-94160398 GCAAGTGGCCCTCCCCAGTGTGG - Intergenic
1061535407 9:131245317-131245339 ACCGGGGGCCCTTCCCTGCCTGG - Intergenic
1061680244 9:132239509-132239531 ACCAGTGGCCCTTCCCTCTCTGG + Intronic
1062012690 9:134275507-134275529 ACCCGGGCTCCTCCCCTGCGGGG - Intergenic
1062129727 9:134885889-134885911 AGCAGCGGCCCTACCCTGGGCGG - Exonic
1062406844 9:136400706-136400728 CCCCGGGGCCCTCCCCTAAGTGG + Intergenic
1062442914 9:136579107-136579129 ACCAGGGGCCCTGTGATGTGGGG - Intergenic
1062581582 9:137231332-137231354 ACCTGGGGACCTCCCCTATCTGG - Intronic
1186276707 X:7947083-7947105 ACTAGGGGCCCTCCCCAATCTGG - Intergenic
1187173956 X:16878805-16878827 ACCTGGGATCCTCCCATGTGGGG + Intergenic
1187360526 X:18622805-18622827 ACCATGGACCCGCCTCTGTGGGG + Intronic
1192582870 X:72299406-72299428 CCCAGGGTCCCTCCCCTGCTGGG - Intronic
1196748366 X:119092255-119092277 ACAAGGGGCCCTTCCATCTGGGG - Intronic
1198272363 X:135066739-135066761 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic
1199825811 X:151498307-151498329 ACCATGGGGCGTACCCTGTGGGG - Intergenic
1200101787 X:153692011-153692033 GCCAGGGGCCCTCAACTGGGAGG + Exonic
1200236500 X:154470218-154470240 TCCATGGCCCCTCCCCTGTAAGG - Intronic
1201234482 Y:11896161-11896183 ATCAGGGGACCTCCCTTGGGAGG - Intergenic
1201309223 Y:12579981-12580003 ACCAGGGCCACTCCCCTGGTTGG + Intergenic
1201423563 Y:13825384-13825406 ACAGGGGGCCCTTCCCTGTTTGG - Intergenic